Incidental Mutation 'R1747:Ap1m2'
ID194056
Institutional Source Beutler Lab
Gene Symbol Ap1m2
Ensembl Gene ENSMUSG00000003309
Gene Nameadaptor protein complex AP-1, mu 2 subunit
SynonymsD9Ertd818e, [m]1B, mu1B
MMRRC Submission 039779-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R1747 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location21294275-21312337 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21305686 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 118 (M118T)
Ref Sequence ENSEMBL: ENSMUSP00000149196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003397] [ENSMUST00000115433] [ENSMUST00000213250] [ENSMUST00000213762]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003397
AA Change: M118T

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000003397
Gene: ENSMUSG00000003309
AA Change: M118T

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.3e-9 PFAM
Pfam:Adap_comp_sub 157 422 7.3e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115433
AA Change: M118T

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111093
Gene: ENSMUSG00000003309
AA Change: M118T

DomainStartEndE-ValueType
Pfam:Clat_adaptor_s 2 141 7.4e-9 PFAM
Pfam:Adap_comp_sub 157 424 4.7e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213250
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213483
Predicted Effect probably damaging
Transcript: ENSMUST00000213762
AA Change: M118T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3315 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the heterotetrameric adaptor-related protein comlex 1 (AP-1), which belongs to the adaptor complexes medium subunits family. This protein is capable of interacting with tyrosine-based sorting signals. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null mice show small intestine crypt hyperplasia and villous dysplasia due to altered polarity and hyperproliferation of epithelial cells, exhibit spontaneous chronic colitis due to epithelial immune dysfunction, and develop a digestive disorder that causes malnutrition, growth retardation and early death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik C T 8: 13,558,814 S117N probably damaging Het
A830010M20Rik T C 5: 107,451,999 S119P probably damaging Het
Acat3 A G 17: 12,924,808 I349T possibly damaging Het
Add3 A G 19: 53,242,550 N552S probably benign Het
Ak3 G T 19: 29,022,861 P217T possibly damaging Het
Aox2 A T 1: 58,339,592 D1000V probably benign Het
Arhgap28 C A 17: 67,901,309 A105S probably benign Het
Arhgef28 T C 13: 97,936,824 E1368G probably damaging Het
Armc7 G A 11: 115,488,757 V94I probably benign Het
Asxl1 C A 2: 153,393,454 T223N possibly damaging Het
Cltc T C 11: 86,707,081 K1078E probably damaging Het
Cpne8 G A 15: 90,584,915 T158I probably benign Het
Csn1s2b T C 5: 87,816,670 probably benign Het
Cyp3a59 A G 5: 146,104,758 I371V probably benign Het
Dennd4c T C 4: 86,807,438 F710L probably damaging Het
Diaph3 T C 14: 87,073,337 D126G probably damaging Het
Dnm3 G A 1: 162,313,584 R369C probably damaging Het
Dst A C 1: 34,160,709 Q86P probably damaging Het
Ern2 C A 7: 122,173,819 probably null Het
Ern2 T A 7: 122,173,820 probably null Het
Exoc6 T A 19: 37,639,769 probably null Het
Glg1 G A 8: 111,197,673 R228C probably damaging Het
Gm4736 G A 6: 132,115,670 noncoding transcript Het
Hmcn2 G C 2: 31,457,985 G4881A probably benign Het
Htr2a T G 14: 74,706,153 F391C probably damaging Het
Htr5b A T 1: 121,527,918 V91E probably damaging Het
Ifi44 T A 3: 151,749,285 H101L probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl6 T A 16: 19,947,028 H608L probably benign Het
Lrp4 T C 2: 91,492,621 V1150A probably damaging Het
Lyst T C 13: 13,757,422 F3545S probably benign Het
Magi3 T C 3: 104,034,173 D822G possibly damaging Het
Nbas G A 12: 13,335,898 S721N probably benign Het
Nog T A 11: 89,301,582 M147L probably benign Het
Npr1 C T 3: 90,458,669 C605Y possibly damaging Het
Olfr1053 G A 2: 86,314,867 L140F probably benign Het
Olfr866 A C 9: 20,027,317 V207G probably benign Het
Pgs1 A G 11: 118,001,631 S10G probably benign Het
Pla2g4c T C 7: 13,337,730 probably benign Het
Prdm14 C T 1: 13,122,403 V371I possibly damaging Het
Prom1 C T 5: 44,007,031 V703I probably benign Het
Ptprk A G 10: 28,354,692 T260A possibly damaging Het
Scnn1g A T 7: 121,760,463 I390F probably damaging Het
Scrt2 C T 2: 152,093,718 H264Y probably damaging Het
Sel1l3 C T 5: 53,145,545 E661K possibly damaging Het
Skiv2l G T 17: 34,847,806 P162H probably benign Het
Slc10a5 G T 3: 10,335,391 Q70K probably benign Het
Smg8 A G 11: 87,085,303 V484A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stag1 T A 9: 100,888,300 S630T probably benign Het
Thyn1 A C 9: 27,005,213 Q98P probably damaging Het
Ttc7 A G 17: 87,307,015 R203G possibly damaging Het
Ttn T C 2: 76,878,516 probably benign Het
Vmn1r236 C T 17: 21,286,917 S99L probably benign Het
Vmn2r50 T A 7: 10,047,678 H380L probably benign Het
Vmn2r73 A T 7: 85,858,167 C646S probably damaging Het
Wnt10b A G 15: 98,774,333 S168P probably benign Het
Zc3h7a A G 16: 11,145,253 M748T possibly damaging Het
Zfp804b C G 5: 6,770,217 E913Q probably benign Het
Zfp974 G T 7: 27,911,081 F406L possibly damaging Het
Zic4 G A 9: 91,384,146 C274Y probably damaging Het
Other mutations in Ap1m2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01811:Ap1m2 APN 9 21299304 missense probably benign 0.01
IGL02320:Ap1m2 APN 9 21299324 nonsense probably null
IGL02533:Ap1m2 APN 9 21296501 missense probably damaging 1.00
IGL02806:Ap1m2 APN 9 21305683 missense probably damaging 1.00
PIT1430001:Ap1m2 UTSW 9 21298252 missense probably damaging 0.98
R0172:Ap1m2 UTSW 9 21298332 splice site probably null
R0498:Ap1m2 UTSW 9 21295833 makesense probably null
R1272:Ap1m2 UTSW 9 21305710 missense possibly damaging 0.85
R1424:Ap1m2 UTSW 9 21298204 missense possibly damaging 0.95
R4477:Ap1m2 UTSW 9 21298213 missense probably benign 0.31
R4478:Ap1m2 UTSW 9 21298213 missense probably benign 0.31
R4573:Ap1m2 UTSW 9 21305758 missense probably damaging 1.00
R4702:Ap1m2 UTSW 9 21298295 missense probably benign 0.24
R4860:Ap1m2 UTSW 9 21309674 missense probably benign
R4860:Ap1m2 UTSW 9 21309674 missense probably benign
R5285:Ap1m2 UTSW 9 21305637 nonsense probably null
R6131:Ap1m2 UTSW 9 21296501 missense probably damaging 1.00
R6191:Ap1m2 UTSW 9 21299305 missense probably benign 0.02
R7262:Ap1m2 UTSW 9 21302466 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- CCAGGACATGATGCATAGGACTCAC -3'
(R):5'- CCTTTGTCTGTAGTCCAGGCACAC -3'

Sequencing Primer
(F):5'- GGTTGACAGACTCAATGACATC -3'
(R):5'- CTGTAGTCCAGGCACACAGTAG -3'
Posted On2014-05-23