Incidental Mutation 'R1747:Thyn1'
ID194057
Institutional Source Beutler Lab
Gene Symbol Thyn1
Ensembl Gene ENSMUSG00000035443
Gene Namethymocyte nuclear protein 1
SynonymsThy28, D730042P09Rik
MMRRC Submission 039779-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1747 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location26999710-27007336 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 27005213 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 98 (Q98P)
Ref Sequence ENSEMBL: ENSMUSP00000151200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034470] [ENSMUST00000039161] [ENSMUST00000213683] [ENSMUST00000213770]
Predicted Effect probably benign
Transcript: ENSMUST00000034470
SMART Domains Protein: ENSMUSP00000034470
Gene: ENSMUSG00000031988

DomainStartEndE-ValueType
Pfam:Vps26 6 281 1e-135 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000039161
AA Change: Q98P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037614
Gene: ENSMUSG00000035443
AA Change: Q98P

DomainStartEndE-ValueType
Pfam:EVE 56 220 3.7e-57 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213683
AA Change: Q98P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000213770
AA Change: Q98P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214910
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215024
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216361
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217143
Meta Mutation Damage Score 0.6732 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is highly conserved among vertebrates and plant species and may be involved in the induction of apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik C T 8: 13,558,814 S117N probably damaging Het
A830010M20Rik T C 5: 107,451,999 S119P probably damaging Het
Acat3 A G 17: 12,924,808 I349T possibly damaging Het
Add3 A G 19: 53,242,550 N552S probably benign Het
Ak3 G T 19: 29,022,861 P217T possibly damaging Het
Aox2 A T 1: 58,339,592 D1000V probably benign Het
Ap1m2 A G 9: 21,305,686 M118T probably damaging Het
Arhgap28 C A 17: 67,901,309 A105S probably benign Het
Arhgef28 T C 13: 97,936,824 E1368G probably damaging Het
Armc7 G A 11: 115,488,757 V94I probably benign Het
Asxl1 C A 2: 153,393,454 T223N possibly damaging Het
Cltc T C 11: 86,707,081 K1078E probably damaging Het
Cpne8 G A 15: 90,584,915 T158I probably benign Het
Csn1s2b T C 5: 87,816,670 probably benign Het
Cyp3a59 A G 5: 146,104,758 I371V probably benign Het
Dennd4c T C 4: 86,807,438 F710L probably damaging Het
Diaph3 T C 14: 87,073,337 D126G probably damaging Het
Dnm3 G A 1: 162,313,584 R369C probably damaging Het
Dst A C 1: 34,160,709 Q86P probably damaging Het
Ern2 C A 7: 122,173,819 probably null Het
Ern2 T A 7: 122,173,820 probably null Het
Exoc6 T A 19: 37,639,769 probably null Het
Glg1 G A 8: 111,197,673 R228C probably damaging Het
Gm4736 G A 6: 132,115,670 noncoding transcript Het
Hmcn2 G C 2: 31,457,985 G4881A probably benign Het
Htr2a T G 14: 74,706,153 F391C probably damaging Het
Htr5b A T 1: 121,527,918 V91E probably damaging Het
Ifi44 T A 3: 151,749,285 H101L probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl6 T A 16: 19,947,028 H608L probably benign Het
Lrp4 T C 2: 91,492,621 V1150A probably damaging Het
Lyst T C 13: 13,757,422 F3545S probably benign Het
Magi3 T C 3: 104,034,173 D822G possibly damaging Het
Nbas G A 12: 13,335,898 S721N probably benign Het
Nog T A 11: 89,301,582 M147L probably benign Het
Npr1 C T 3: 90,458,669 C605Y possibly damaging Het
Olfr1053 G A 2: 86,314,867 L140F probably benign Het
Olfr866 A C 9: 20,027,317 V207G probably benign Het
Pgs1 A G 11: 118,001,631 S10G probably benign Het
Pla2g4c T C 7: 13,337,730 probably benign Het
Prdm14 C T 1: 13,122,403 V371I possibly damaging Het
Prom1 C T 5: 44,007,031 V703I probably benign Het
Ptprk A G 10: 28,354,692 T260A possibly damaging Het
Scnn1g A T 7: 121,760,463 I390F probably damaging Het
Scrt2 C T 2: 152,093,718 H264Y probably damaging Het
Sel1l3 C T 5: 53,145,545 E661K possibly damaging Het
Skiv2l G T 17: 34,847,806 P162H probably benign Het
Slc10a5 G T 3: 10,335,391 Q70K probably benign Het
Smg8 A G 11: 87,085,303 V484A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stag1 T A 9: 100,888,300 S630T probably benign Het
Ttc7 A G 17: 87,307,015 R203G possibly damaging Het
Ttn T C 2: 76,878,516 probably benign Het
Vmn1r236 C T 17: 21,286,917 S99L probably benign Het
Vmn2r50 T A 7: 10,047,678 H380L probably benign Het
Vmn2r73 A T 7: 85,858,167 C646S probably damaging Het
Wnt10b A G 15: 98,774,333 S168P probably benign Het
Zc3h7a A G 16: 11,145,253 M748T possibly damaging Het
Zfp804b C G 5: 6,770,217 E913Q probably benign Het
Zfp974 G T 7: 27,911,081 F406L possibly damaging Het
Zic4 G A 9: 91,384,146 C274Y probably damaging Het
Other mutations in Thyn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Thyn1 APN 9 27003774 missense probably benign 0.17
Conception UTSW 9 27005213 missense probably damaging 1.00
R1858:Thyn1 UTSW 9 27003774 missense probably benign 0.17
R2509:Thyn1 UTSW 9 27000020 missense possibly damaging 0.92
R4407:Thyn1 UTSW 9 27003597 missense possibly damaging 0.94
R5693:Thyn1 UTSW 9 27005215 critical splice donor site probably null
R6998:Thyn1 UTSW 9 27006442 missense probably damaging 0.98
R7219:Thyn1 UTSW 9 27005210 missense probably damaging 1.00
R7703:Thyn1 UTSW 9 27006847 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACGTTCAACACCAGTGACTCCCTG -3'
(R):5'- AGTTCCGAGCCTGTGTCAAAGAAG -3'

Sequencing Primer
(F):5'- AGTAACCTACCTAGCTCCTTTACAG -3'
(R):5'- TTGTTCCAGGACACTAGCCAG -3'
Posted On2014-05-23