Incidental Mutation 'R0035:Kmt2e'
ID19406
Institutional Source Beutler Lab
Gene Symbol Kmt2e
Ensembl Gene ENSMUSG00000029004
Gene Namelysine (K)-specific methyltransferase 2E
SynonymsD230038D11Rik, 9530077A04Rik, 1810033J14Rik, Mll5
MMRRC Submission 038329-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0035 (G1)
Quality Score183
Status Validated
Chromosome5
Chromosomal Location23434441-23504235 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 23485621 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094962] [ENSMUST00000115128] [ENSMUST00000146375] [ENSMUST00000196260] [ENSMUST00000196889]
Predicted Effect probably benign
Transcript: ENSMUST00000094962
SMART Domains Protein: ENSMUSP00000092569
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000115128
SMART Domains Protein: ENSMUSP00000110781
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 4.25e-8 SMART
SET 328 453 2.13e-26 SMART
low complexity region 487 503 N/A INTRINSIC
low complexity region 569 582 N/A INTRINSIC
low complexity region 854 867 N/A INTRINSIC
low complexity region 882 908 N/A INTRINSIC
low complexity region 933 945 N/A INTRINSIC
low complexity region 951 960 N/A INTRINSIC
low complexity region 1184 1197 N/A INTRINSIC
low complexity region 1214 1237 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1348 1367 N/A INTRINSIC
internal_repeat_1 1434 1496 6.13e-7 PROSPERO
low complexity region 1506 1518 N/A INTRINSIC
low complexity region 1625 1641 N/A INTRINSIC
low complexity region 1677 1705 N/A INTRINSIC
low complexity region 1720 1731 N/A INTRINSIC
internal_repeat_1 1783 1842 6.13e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000146375
SMART Domains Protein: ENSMUSP00000142547
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 104 117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157545
Predicted Effect probably benign
Transcript: ENSMUST00000196260
SMART Domains Protein: ENSMUSP00000143791
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 49 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196889
SMART Domains Protein: ENSMUSP00000142568
Gene: ENSMUSG00000029004

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 48 55 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
low complexity region 100 109 N/A INTRINSIC
PHD 120 164 2.7e-10 SMART
Blast:SET 216 327 6e-61 BLAST
Blast:SET 328 377 3e-26 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200330
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a protein with an N-terminal PHD zinc finger and a central SET domain. Overexpression of the protein inhibits cell cycle progression. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal and postnatal lethality, reduced fertility and growth, and abnormal lymphopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik T C 7: 81,788,549 T20A probably benign Het
4932438A13Rik T A 3: 36,987,598 Y2708* probably null Het
9130011E15Rik A T 19: 45,891,240 M558K probably damaging Het
Aadacl4 A G 4: 144,617,941 T96A probably damaging Het
Abcb6 A G 1: 75,175,007 V473A possibly damaging Het
Abo C A 2: 26,843,373 K273N possibly damaging Het
Acvr1c A G 2: 58,315,779 probably benign Het
Adcy8 A T 15: 64,699,368 V1142D probably benign Het
Akna T A 4: 63,382,445 H591L probably benign Het
Aox2 T C 1: 58,354,422 V1247A probably benign Het
Ap4b1 T C 3: 103,820,664 probably benign Het
Atm A G 9: 53,513,180 V607A probably benign Het
Cass4 C T 2: 172,416,492 P137S probably damaging Het
Cfap53 A G 18: 74,300,207 E121G probably damaging Het
Chmp6 T C 11: 119,916,682 V31A probably damaging Het
Clec4a3 T A 6: 122,967,549 Y185N probably damaging Het
Clic5 A G 17: 44,275,313 T230A probably damaging Het
Clspn G T 4: 126,565,003 probably null Het
Cntn1 T A 15: 92,232,088 probably benign Het
Col4a3 G A 1: 82,672,753 G577R unknown Het
Defa21 T A 8: 21,025,768 probably null Het
Deup1 T C 9: 15,599,821 R221G possibly damaging Het
Dnah8 A T 17: 30,683,621 probably benign Het
Dnase1l2 A G 17: 24,441,075 V273A probably damaging Het
Gm5134 T A 10: 75,993,864 F328Y probably benign Het
Golph3 A T 15: 12,339,690 E96D probably damaging Het
Hspd1 A G 1: 55,083,783 V151A probably benign Het
Htr1f A C 16: 64,926,497 I144S probably damaging Het
Il1f8 A T 2: 24,159,878 H167L probably benign Het
Il23r A G 6: 67,473,788 probably benign Het
Il25 A G 14: 54,933,096 E42G probably damaging Het
Klrb1-ps1 C T 6: 129,129,343 A149V possibly damaging Het
Ktn1 A G 14: 47,730,379 N1167D probably benign Het
Lama4 T A 10: 39,072,738 D832E probably benign Het
Map1b A G 13: 99,435,338 S292P probably damaging Het
Map6 C T 7: 99,317,608 T345I probably damaging Het
Mark2 A T 19: 7,284,652 probably benign Het
Me3 C A 7: 89,851,759 H559Q probably benign Het
Myo1b A G 1: 51,778,382 F574L probably damaging Het
Nos2 T C 11: 78,945,727 S431P probably damaging Het
Nr1h5 T A 3: 102,949,573 K208* probably null Het
Nup214 T C 2: 31,990,367 probably null Het
Obp2b T C 2: 25,738,633 L133P probably damaging Het
Olfr173 A T 16: 58,797,122 C241* probably null Het
Olfr305 T C 7: 86,364,187 D50G possibly damaging Het
Osbp2 C T 11: 3,717,997 probably benign Het
Ptafr C A 4: 132,579,553 L85I probably benign Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Rad50 A G 11: 53,655,027 probably benign Het
Rasef G T 4: 73,762,854 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Tbc1d1 T A 5: 64,256,737 I18N probably damaging Het
Tbc1d17 T C 7: 44,841,408 N587D probably benign Het
Trank1 A T 9: 111,366,776 K1289N probably benign Het
Tspyl3 A G 2: 153,224,320 S333P probably damaging Het
Ush2a G A 1: 188,356,888 V347I probably benign Het
Usp17le G T 7: 104,769,062 S291* probably null Het
Usp24 T A 4: 106,368,027 S619T probably benign Het
Vmn2r10 T C 5: 108,997,601 probably benign Het
Vmn2r78 A G 7: 86,920,205 E102G probably benign Het
Vwa3b G A 1: 37,165,689 V85I possibly damaging Het
Wwp1 A C 4: 19,631,116 I639R probably damaging Het
Xpo5 A G 17: 46,240,175 T1001A probably benign Het
Zc3h12c A T 9: 52,143,747 M235K probably benign Het
Zfp619 G A 7: 39,537,282 G912D probably damaging Het
Other mutations in Kmt2e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Kmt2e APN 5 23492358 missense probably damaging 0.99
IGL01330:Kmt2e APN 5 23497948 missense possibly damaging 0.95
IGL01457:Kmt2e APN 5 23502019 missense possibly damaging 0.62
IGL01691:Kmt2e APN 5 23497091 missense probably benign
IGL02274:Kmt2e APN 5 23500760 missense probably benign 0.00
IGL02934:Kmt2e APN 5 23497884 missense probably damaging 0.97
IGL02964:Kmt2e APN 5 23467100 splice site probably benign
IGL03011:Kmt2e APN 5 23497542 missense probably damaging 1.00
IGL03291:Kmt2e APN 5 23499291 missense probably damaging 1.00
R0446:Kmt2e UTSW 5 23497534 splice site probably null
R0498:Kmt2e UTSW 5 23478972 nonsense probably null
R0699:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0701:Kmt2e UTSW 5 23473583 missense probably benign 0.01
R0761:Kmt2e UTSW 5 23503034 nonsense probably null
R1110:Kmt2e UTSW 5 23502655 missense probably damaging 1.00
R1295:Kmt2e UTSW 5 23502404 missense probably damaging 0.99
R1432:Kmt2e UTSW 5 23450321 missense probably benign 0.39
R1495:Kmt2e UTSW 5 23499327 missense possibly damaging 0.83
R1505:Kmt2e UTSW 5 23500535 missense probably null 0.01
R1623:Kmt2e UTSW 5 23482502 missense probably damaging 1.00
R1675:Kmt2e UTSW 5 23482453 nonsense probably null
R1691:Kmt2e UTSW 5 23464849 missense probably damaging 1.00
R1778:Kmt2e UTSW 5 23492364 missense probably damaging 1.00
R1820:Kmt2e UTSW 5 23473547 missense probably damaging 1.00
R1846:Kmt2e UTSW 5 23499486 intron probably benign
R1912:Kmt2e UTSW 5 23492395 missense probably benign 0.07
R2070:Kmt2e UTSW 5 23501995 missense probably benign
R2195:Kmt2e UTSW 5 23502196 unclassified probably null
R2571:Kmt2e UTSW 5 23501887 missense probably benign 0.08
R3901:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3902:Kmt2e UTSW 5 23501642 missense probably benign 0.02
R3905:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3906:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3909:Kmt2e UTSW 5 23501626 missense probably benign 0.01
R3956:Kmt2e UTSW 5 23496025 missense probably benign 0.00
R4242:Kmt2e UTSW 5 23502822 unclassified probably benign
R4299:Kmt2e UTSW 5 23464914 missense probably damaging 1.00
R4448:Kmt2e UTSW 5 23464790 missense possibly damaging 0.80
R4528:Kmt2e UTSW 5 23473558 missense possibly damaging 0.69
R4574:Kmt2e UTSW 5 23492407 missense possibly damaging 0.60
R4719:Kmt2e UTSW 5 23492315 missense probably damaging 1.00
R4754:Kmt2e UTSW 5 23482441 missense possibly damaging 0.88
R4787:Kmt2e UTSW 5 23463083 missense possibly damaging 0.65
R4812:Kmt2e UTSW 5 23502587 missense possibly damaging 0.86
R4853:Kmt2e UTSW 5 23502341 missense probably damaging 1.00
R5138:Kmt2e UTSW 5 23502695 missense probably damaging 0.99
R5306:Kmt2e UTSW 5 23499333 missense probably damaging 0.98
R5659:Kmt2e UTSW 5 23497807 missense probably damaging 0.99
R5907:Kmt2e UTSW 5 23464706 missense probably damaging 1.00
R5920:Kmt2e UTSW 5 23499442 missense possibly damaging 0.50
R6280:Kmt2e UTSW 5 23499516 missense possibly damaging 0.48
R6353:Kmt2e UTSW 5 23493245 missense probably damaging 1.00
R6375:Kmt2e UTSW 5 23499519 missense probably benign
R6553:Kmt2e UTSW 5 23463026 missense probably damaging 0.99
R6572:Kmt2e UTSW 5 23497581 missense possibly damaging 0.66
R6678:Kmt2e UTSW 5 23499295 missense possibly damaging 0.54
R6791:Kmt2e UTSW 5 23499476 intron probably benign
R6792:Kmt2e UTSW 5 23499476 intron probably benign
R6794:Kmt2e UTSW 5 23499476 intron probably benign
R6797:Kmt2e UTSW 5 23482507 missense possibly damaging 0.82
R6947:Kmt2e UTSW 5 23497545 missense probably damaging 1.00
R7023:Kmt2e UTSW 5 23500487 missense possibly damaging 0.46
R7036:Kmt2e UTSW 5 23478743 missense probably null 1.00
R7173:Kmt2e UTSW 5 23464857 missense probably damaging 1.00
R7202:Kmt2e UTSW 5 23492294 unclassified probably benign
R7563:Kmt2e UTSW 5 23500273 missense probably damaging 1.00
R7571:Kmt2e UTSW 5 23478587 missense probably damaging 1.00
R7604:Kmt2e UTSW 5 23501765 missense not run
R7722:Kmt2e UTSW 5 23497018 missense probably benign 0.00
R7758:Kmt2e UTSW 5 23496070 missense possibly damaging 0.92
R7794:Kmt2e UTSW 5 23464716 missense probably damaging 1.00
RF026:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF028:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF040:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
RF042:Kmt2e UTSW 5 23478509 critical splice acceptor site probably benign
Z1177:Kmt2e UTSW 5 23481208 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTCAAGGAAAATCCAGAGTGCC -3'
(R):5'- TGGAGCACCAACAGAGAACTTGCC -3'

Sequencing Primer
(F):5'- TGTTCTCAAGCGAAGCTCG -3'
(R):5'- ACTTGCCAAGGGTATGGTAGC -3'
Posted On2013-04-11