Mutagenetix > Incidental Mutation

Incidental Mutation 'R1747:Nog'

194064

Institutional Source

Beutler Lab

Gene Symbol

Nog

Ensembl Gene

ENSMUSG00000048616

Gene Name

noggin

Synonyms

MMRRC Submission

039779-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1747 (G1)

Quality Score

166

Status

Validated

Chromosome

Chromosomal Location

89191464-89193158 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89192408 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 147 (M147L)

Ref Sequence

ENSEMBL: ENSMUSP00000061427 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061728]

AlphaFold

P97466

Predicted Effect

probably benign
Transcript: ENSMUST00000061728
AA Change: M147L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000061427
Gene: ENSMUSG00000048616
AA Change: M147L

Domain	Start	End	E-Value	Type
Pfam:Noggin	12	232	4.4e-105	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140754

Meta Mutation Damage Score

0.0999

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.7%

Validation Efficiency

97% (65/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The secreted polypeptide, encoded by this gene, binds and inactivates members of the transforming growth factor-beta (TGF-beta) superfamily signaling proteins, such as bone morphogenetic protein-4 (BMP4). By diffusing through extracellular matrices more efficiently than members of the TGF-beta superfamily, this protein may have a principal role in creating morphogenic gradients. The protein appears to have pleiotropic effect, both early in development as well as in later stages. It was originally isolated from Xenopus based on its ability to restore normal dorsal-ventral body axis in embryos that had been artificially ventralized by UV treatment. The results of the mouse knockout of the ortholog suggest that it is involved in numerous developmental processes, such as neural tube fusion and joint formation. Recently, several dominant human NOG mutations in unrelated families with proximal symphalangism (SYM1) and multiple synostoses syndrome (SYNS1) were identified; both SYM1 and SYNS1 have multiple joint fusion as their principal feature, and map to the same region (17q22) as this gene. All of these mutations altered evolutionarily conserved amino acid residues. The amino acid sequence of this human gene is highly homologous to that of Xenopus, rat and mouse. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failed closure of neural tube, exencephaly, wide club-shaped limbs, loss of tail vertebrae, shortened body axis, abnormal cartilage condensations, and lethality at birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	C	T	8: 13,608,814 (GRCm39)	S117N	probably damaging	Het
Acat3	A	G	17: 13,143,695 (GRCm39)	I349T	possibly damaging	Het
Add3	A	G	19: 53,230,981 (GRCm39)	N552S	probably benign	Het
Ak3	G	T	19: 29,000,261 (GRCm39)	P217T	possibly damaging	Het
Aox1	A	T	1: 58,378,751 (GRCm39)	D1000V	probably benign	Het
Ap1m2	A	G	9: 21,216,982 (GRCm39)	M118T	probably damaging	Het
Arhgap28	C	A	17: 68,208,304 (GRCm39)	A105S	probably benign	Het
Arhgef28	T	C	13: 98,073,332 (GRCm39)	E1368G	probably damaging	Het
Armc7	G	A	11: 115,379,583 (GRCm39)	V94I	probably benign	Het
Asxl1	C	A	2: 153,235,374 (GRCm39)	T223N	possibly damaging	Het
Btbd8	T	C	5: 107,599,865 (GRCm39)	S119P	probably damaging	Het
Cltc	T	C	11: 86,597,907 (GRCm39)	K1078E	probably damaging	Het
Cpne8	G	A	15: 90,469,118 (GRCm39)	T158I	probably benign	Het
Csn1s2b	T	C	5: 87,964,529 (GRCm39)		probably benign	Het
Cyp3a59	A	G	5: 146,041,568 (GRCm39)	I371V	probably benign	Het
Dennd4c	T	C	4: 86,725,675 (GRCm39)	F710L	probably damaging	Het
Diaph3	T	C	14: 87,310,773 (GRCm39)	D126G	probably damaging	Het
Dnm3	G	A	1: 162,141,153 (GRCm39)	R369C	probably damaging	Het
Dst	A	C	1: 34,199,790 (GRCm39)	Q86P	probably damaging	Het
Ern2	C	A	7: 121,773,042 (GRCm39)		probably null	Het
Ern2	T	A	7: 121,773,043 (GRCm39)		probably null	Het
Exoc6	T	A	19: 37,628,217 (GRCm39)		probably null	Het
Glg1	G	A	8: 111,924,305 (GRCm39)	R228C	probably damaging	Het
Gm4736	G	A	6: 132,092,633 (GRCm39)		noncoding transcript	Het
Hmcn2	G	C	2: 31,347,997 (GRCm39)	G4881A	probably benign	Het
Htr2a	T	G	14: 74,943,593 (GRCm39)	F391C	probably damaging	Het
Htr5b	A	T	1: 121,455,647 (GRCm39)	V91E	probably damaging	Het
Ifi44	T	A	3: 151,454,922 (GRCm39)	H101L	probably benign	Het
Ip6k1	G	A	9: 107,918,195 (GRCm39)	E77K	possibly damaging	Het
Klhl6	T	A	16: 19,765,778 (GRCm39)	H608L	probably benign	Het
Lrp4	T	C	2: 91,322,966 (GRCm39)	V1150A	probably damaging	Het
Lyst	T	C	13: 13,932,007 (GRCm39)	F3545S	probably benign	Het
Magi3	T	C	3: 103,941,489 (GRCm39)	D822G	possibly damaging	Het
Nbas	G	A	12: 13,385,899 (GRCm39)	S721N	probably benign	Het
Npr1	C	T	3: 90,365,976 (GRCm39)	C605Y	possibly damaging	Het
Or7e173	A	C	9: 19,938,613 (GRCm39)	V207G	probably benign	Het
Or8k21	G	A	2: 86,145,211 (GRCm39)	L140F	probably benign	Het
Pgs1	A	G	11: 117,892,457 (GRCm39)	S10G	probably benign	Het
Pla2g4c	T	C	7: 13,071,655 (GRCm39)		probably benign	Het
Prdm14	C	T	1: 13,192,627 (GRCm39)	V371I	possibly damaging	Het
Prom1	C	T	5: 44,164,373 (GRCm39)	V703I	probably benign	Het
Ptprk	A	G	10: 28,230,688 (GRCm39)	T260A	possibly damaging	Het
Scnn1g	A	T	7: 121,359,686 (GRCm39)	I390F	probably damaging	Het
Scrt2	C	T	2: 151,935,638 (GRCm39)	H264Y	probably damaging	Het
Sel1l3	C	T	5: 53,302,887 (GRCm39)	E661K	possibly damaging	Het
Skic2	G	T	17: 35,066,782 (GRCm39)	P162H	probably benign	Het
Slc10a5	G	T	3: 10,400,451 (GRCm39)	Q70K	probably benign	Het
Smg8	A	G	11: 86,976,129 (GRCm39)	V484A	possibly damaging	Het
Sp110	C	G	1: 85,516,839 (GRCm39)	E219D	probably damaging	Het
Stag1	T	A	9: 100,770,353 (GRCm39)	S630T	probably benign	Het
Thyn1	A	C	9: 26,916,509 (GRCm39)	Q98P	probably damaging	Het
Ttc7	A	G	17: 87,614,443 (GRCm39)	R203G	possibly damaging	Het
Ttn	T	C	2: 76,708,860 (GRCm39)		probably benign	Het
Vmn1r236	C	T	17: 21,507,179 (GRCm39)	S99L	probably benign	Het
Vmn2r50	T	A	7: 9,781,605 (GRCm39)	H380L	probably benign	Het
Vmn2r73	A	T	7: 85,507,375 (GRCm39)	C646S	probably damaging	Het
Wnt10b	A	G	15: 98,672,214 (GRCm39)	S168P	probably benign	Het
Zc3h7a	A	G	16: 10,963,117 (GRCm39)	M748T	possibly damaging	Het
Zfp804b	C	G	5: 6,820,217 (GRCm39)	E913Q	probably benign	Het
Zfp974	G	T	7: 27,610,506 (GRCm39)	F406L	possibly damaging	Het
Zic4	G	A	9: 91,266,199 (GRCm39)	C274Y	probably damaging	Het

Other mutations in Nog

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R4553:Nog	UTSW	11	89,192,248 (GRCm39)	missense	probably damaging	1.00
R5763:Nog	UTSW	11	89,192,291 (GRCm39)	missense	probably damaging	1.00
R5863:Nog	UTSW	11	89,192,356 (GRCm39)	missense	probably damaging	1.00
R9129:Nog	UTSW	11	89,192,602 (GRCm39)	missense	probably damaging	0.99
R9722:Nog	UTSW	11	89,192,396 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACAGACTTGGATGGCTTACACAC -3'
(R):5'- AAGGATCTGAACGAGACGCTGCTG -3'

Sequencing Primer
(F):5'- GGATGGCTTACACACCATGC -3'
(R):5'- TACTTCGCCCCCTGAGGAC -3'

Posted On

2014-05-23