Incidental Mutation 'R1747:Add3'
ID194085
Institutional Source Beutler Lab
Gene Symbol Add3
Ensembl Gene ENSMUSG00000025026
Gene Nameadducin 3 (gamma)
Synonyms
MMRRC Submission 039779-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1747 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location53140445-53247399 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53242550 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 552 (N552S)
Ref Sequence ENSEMBL: ENSMUSP00000107370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025999] [ENSMUST00000050096] [ENSMUST00000111741]
Predicted Effect probably benign
Transcript: ENSMUST00000025999
AA Change: N552S

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025999
Gene: ENSMUSG00000025026
AA Change: N552S

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000050096
AA Change: N552S

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052245
Gene: ENSMUSG00000025026
AA Change: N552S

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
low complexity region 618 630 N/A INTRINSIC
low complexity region 641 671 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111741
AA Change: N552S

PolyPhen 2 Score 0.410 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107370
Gene: ENSMUSG00000025026
AA Change: N552S

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 101 114 N/A INTRINSIC
Aldolase_II 139 321 1.62e-46 SMART
coiled coil region 556 582 N/A INTRINSIC
low complexity region 590 605 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 673 703 N/A INTRINSIC
Meta Mutation Damage Score 0.7122 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal blood pressure and show no significant alterations in red blood cell or platelet structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik C T 8: 13,558,814 S117N probably damaging Het
A830010M20Rik T C 5: 107,451,999 S119P probably damaging Het
Acat3 A G 17: 12,924,808 I349T possibly damaging Het
Ak3 G T 19: 29,022,861 P217T possibly damaging Het
Aox2 A T 1: 58,339,592 D1000V probably benign Het
Ap1m2 A G 9: 21,305,686 M118T probably damaging Het
Arhgap28 C A 17: 67,901,309 A105S probably benign Het
Arhgef28 T C 13: 97,936,824 E1368G probably damaging Het
Armc7 G A 11: 115,488,757 V94I probably benign Het
Asxl1 C A 2: 153,393,454 T223N possibly damaging Het
Cltc T C 11: 86,707,081 K1078E probably damaging Het
Cpne8 G A 15: 90,584,915 T158I probably benign Het
Csn1s2b T C 5: 87,816,670 probably benign Het
Cyp3a59 A G 5: 146,104,758 I371V probably benign Het
Dennd4c T C 4: 86,807,438 F710L probably damaging Het
Diaph3 T C 14: 87,073,337 D126G probably damaging Het
Dnm3 G A 1: 162,313,584 R369C probably damaging Het
Dst A C 1: 34,160,709 Q86P probably damaging Het
Ern2 C A 7: 122,173,819 probably null Het
Ern2 T A 7: 122,173,820 probably null Het
Exoc6 T A 19: 37,639,769 probably null Het
Glg1 G A 8: 111,197,673 R228C probably damaging Het
Gm4736 G A 6: 132,115,670 noncoding transcript Het
Hmcn2 G C 2: 31,457,985 G4881A probably benign Het
Htr2a T G 14: 74,706,153 F391C probably damaging Het
Htr5b A T 1: 121,527,918 V91E probably damaging Het
Ifi44 T A 3: 151,749,285 H101L probably benign Het
Ip6k1 G A 9: 108,040,996 E77K possibly damaging Het
Klhl6 T A 16: 19,947,028 H608L probably benign Het
Lrp4 T C 2: 91,492,621 V1150A probably damaging Het
Lyst T C 13: 13,757,422 F3545S probably benign Het
Magi3 T C 3: 104,034,173 D822G possibly damaging Het
Nbas G A 12: 13,335,898 S721N probably benign Het
Nog T A 11: 89,301,582 M147L probably benign Het
Npr1 C T 3: 90,458,669 C605Y possibly damaging Het
Olfr1053 G A 2: 86,314,867 L140F probably benign Het
Olfr866 A C 9: 20,027,317 V207G probably benign Het
Pgs1 A G 11: 118,001,631 S10G probably benign Het
Pla2g4c T C 7: 13,337,730 probably benign Het
Prdm14 C T 1: 13,122,403 V371I possibly damaging Het
Prom1 C T 5: 44,007,031 V703I probably benign Het
Ptprk A G 10: 28,354,692 T260A possibly damaging Het
Scnn1g A T 7: 121,760,463 I390F probably damaging Het
Scrt2 C T 2: 152,093,718 H264Y probably damaging Het
Sel1l3 C T 5: 53,145,545 E661K possibly damaging Het
Skiv2l G T 17: 34,847,806 P162H probably benign Het
Slc10a5 G T 3: 10,335,391 Q70K probably benign Het
Smg8 A G 11: 87,085,303 V484A possibly damaging Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Stag1 T A 9: 100,888,300 S630T probably benign Het
Thyn1 A C 9: 27,005,213 Q98P probably damaging Het
Ttc7 A G 17: 87,307,015 R203G possibly damaging Het
Ttn T C 2: 76,878,516 probably benign Het
Vmn1r236 C T 17: 21,286,917 S99L probably benign Het
Vmn2r50 T A 7: 10,047,678 H380L probably benign Het
Vmn2r73 A T 7: 85,858,167 C646S probably damaging Het
Wnt10b A G 15: 98,774,333 S168P probably benign Het
Zc3h7a A G 16: 11,145,253 M748T possibly damaging Het
Zfp804b C G 5: 6,770,217 E913Q probably benign Het
Zfp974 G T 7: 27,911,081 F406L possibly damaging Het
Zic4 G A 9: 91,384,146 C274Y probably damaging Het
Other mutations in Add3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Add3 APN 19 53239430 missense probably damaging 1.00
IGL02177:Add3 APN 19 53216892 nonsense probably null
IGL03093:Add3 APN 19 53231207 missense probably damaging 1.00
IGL03047:Add3 UTSW 19 53242591 missense probably benign 0.00
PIT4243001:Add3 UTSW 19 53236690 missense probably benign 0.00
PIT4366001:Add3 UTSW 19 53216867 missense unknown
R0087:Add3 UTSW 19 53226607 missense probably damaging 1.00
R0335:Add3 UTSW 19 53236828 missense probably benign 0.00
R0346:Add3 UTSW 19 53216956 nonsense probably null
R0514:Add3 UTSW 19 53236843 nonsense probably null
R0692:Add3 UTSW 19 53216952 missense probably damaging 1.00
R1437:Add3 UTSW 19 53233678 missense probably damaging 0.98
R2926:Add3 UTSW 19 53226822 splice site probably null
R4192:Add3 UTSW 19 53242524 missense probably benign 0.00
R4780:Add3 UTSW 19 53234792 missense possibly damaging 0.64
R5019:Add3 UTSW 19 53242571 missense probably damaging 0.99
R5486:Add3 UTSW 19 53244387 missense probably benign 0.00
R5526:Add3 UTSW 19 53226607 missense probably damaging 1.00
R5580:Add3 UTSW 19 53245211 missense probably damaging 1.00
R5851:Add3 UTSW 19 53236774 missense probably damaging 1.00
R5863:Add3 UTSW 19 53233870 missense probably benign 0.00
R5951:Add3 UTSW 19 53244289 splice site probably null
R6229:Add3 UTSW 19 53234846 missense probably benign 0.35
R7017:Add3 UTSW 19 53233853 missense possibly damaging 0.94
R7190:Add3 UTSW 19 53216899 nonsense probably null
R7222:Add3 UTSW 19 53216846 missense unknown
R7231:Add3 UTSW 19 53233146 missense probably benign 0.00
R7532:Add3 UTSW 19 53232158 missense probably damaging 1.00
R7557:Add3 UTSW 19 53239437 missense probably damaging 0.98
R7726:Add3 UTSW 19 53239461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCGCCATAGGCTGATTTTGC -3'
(R):5'- CGCTGATGACATTCCGAGACGAAC -3'

Sequencing Primer
(F):5'- attgatttggactgcttcagatag -3'
(R):5'- TTCCGAGACGAACAGGTTCC -3'
Posted On2014-05-23