Incidental Mutation 'R1748:Cr2'
ID 194090
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 039780-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R1748 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 194838213 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Stop codon at position 1084 (K1084*)
Ref Sequence ENSEMBL: ENSMUSP00000147804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082321] [ENSMUST00000193356] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000082321
AA Change: K708*
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616
AA Change: K708*

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192604
Predicted Effect probably null
Transcript: ENSMUST00000193356
AA Change: K411*
SMART Domains Protein: ENSMUSP00000141706
Gene: ENSMUSG00000026616
AA Change: K411*

DomainStartEndE-ValueType
CCP 1 46 1.2e-1 SMART
CCP 55 110 5.9e-16 SMART
CCP 114 170 1.1e-18 SMART
CCP 175 226 6.1e-3 SMART
CCP 231 297 2.2e-15 SMART
CCP 306 361 9.4e-16 SMART
CCP 421 481 8.3e-18 SMART
CCP 490 545 1e-14 SMART
CCP 553 609 4e-16 SMART
CCP 614 670 6.2e-16 SMART
transmembrane domain 678 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193436
Predicted Effect probably benign
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000195120
AA Change: K708*
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616
AA Change: K708*

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably null
Transcript: ENSMUST00000210219
AA Change: K1084*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195737
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,152,338 (GRCm39) Q1403K probably benign Het
Adamts12 G A 15: 11,241,548 (GRCm39) M373I probably damaging Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Aire T C 10: 77,879,314 (GRCm39) H15R probably damaging Het
Aldh3b2 T C 19: 4,027,572 (GRCm39) F38L probably damaging Het
Alk A C 17: 72,910,416 (GRCm39) C97G probably benign Het
Ano8 T C 8: 71,931,602 (GRCm39) probably benign Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arsk T A 13: 76,210,529 (GRCm39) H506L probably benign Het
Asgr2 G T 11: 69,987,658 (GRCm39) R52L probably damaging Het
Atp2a1 A G 7: 126,058,780 (GRCm39) I145T possibly damaging Het
Atrnl1 A G 19: 57,703,134 (GRCm39) T1051A probably damaging Het
Cacna1e A T 1: 154,362,315 (GRCm39) V424D possibly damaging Het
Capn3 T C 2: 120,327,494 (GRCm39) V574A probably benign Het
Capzb C A 4: 138,984,679 (GRCm39) D67E probably damaging Het
Ccdc68 A T 18: 70,089,062 (GRCm39) T202S probably benign Het
Ccser2 T C 14: 36,618,270 (GRCm39) K123R probably damaging Het
Ccser2 T A 14: 36,618,271 (GRCm39) K123* probably null Het
Ces2h T C 8: 105,744,473 (GRCm39) I316T probably benign Het
Chd3 T G 11: 69,255,523 (GRCm39) K122Q possibly damaging Het
Col12a1 T C 9: 79,580,279 (GRCm39) T1533A probably benign Het
Ddx28 A G 8: 106,737,314 (GRCm39) L248P probably benign Het
Depdc5 A G 5: 33,075,286 (GRCm39) E488G probably benign Het
Dld T C 12: 31,384,745 (GRCm39) T305A probably benign Het
Dok5 T A 2: 170,683,373 (GRCm39) F211L probably damaging Het
Duox2 T C 2: 122,117,532 (GRCm39) D934G probably benign Het
Eif3a G A 19: 60,755,236 (GRCm39) T982I unknown Het
Erbb2 G T 11: 98,326,161 (GRCm39) R979L probably benign Het
Espl1 G T 15: 102,206,964 (GRCm39) V143L possibly damaging Het
Fanci T C 7: 79,080,236 (GRCm39) L598P probably damaging Het
Fat2 T A 11: 55,147,473 (GRCm39) E3923V probably damaging Het
Fhod3 A T 18: 24,903,550 (GRCm39) K95* probably null Het
Gpr108 G T 17: 57,543,217 (GRCm39) T484K probably damaging Het
Hao1 T A 2: 134,340,238 (GRCm39) N351I possibly damaging Het
Hepacam A T 9: 37,295,189 (GRCm39) N308I possibly damaging Het
Herc2 T C 7: 55,798,571 (GRCm39) probably null Het
Hltf T C 3: 20,130,685 (GRCm39) I301T probably benign Het
Igsf10 A T 3: 59,226,514 (GRCm39) N2386K probably damaging Het
Ikbke G T 1: 131,186,937 (GRCm39) T585K probably benign Het
Iqgap3 A G 3: 88,021,287 (GRCm39) T448A possibly damaging Het
Kl T C 5: 150,904,450 (GRCm39) S401P possibly damaging Het
Lama4 T C 10: 38,941,615 (GRCm39) V684A probably benign Het
Lgals8 A T 13: 12,469,824 (GRCm39) F45Y probably damaging Het
Lgalsl G A 11: 20,776,491 (GRCm39) R134C probably benign Het
Lmcd1 T C 6: 112,306,875 (GRCm39) V349A probably benign Het
Lrp1b T A 2: 41,618,718 (GRCm39) N119Y possibly damaging Het
Lrrc73 T A 17: 46,566,621 (GRCm39) I157N probably damaging Het
Map3k8 A G 18: 4,334,766 (GRCm39) Y293H probably damaging Het
Mybphl A T 3: 108,282,400 (GRCm39) probably null Het
Naa12 T C 18: 80,255,161 (GRCm39) S152P probably benign Het
Ndrg1 A G 15: 66,802,930 (GRCm39) M140T possibly damaging Het
Or2n1e T A 17: 38,585,997 (GRCm39) C112S possibly damaging Het
Or8b38 A G 9: 37,972,796 (GRCm39) Y60C probably damaging Het
Pbx2 T C 17: 34,812,951 (GRCm39) S76P possibly damaging Het
Plcl2 T A 17: 50,913,826 (GRCm39) S278R probably benign Het
Polr3d A T 14: 70,676,915 (GRCm39) L393* probably null Het
Prmt6 T C 3: 110,157,683 (GRCm39) Q202R probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Sag T A 1: 87,759,662 (GRCm39) I300N probably damaging Het
Sap25 T A 5: 137,640,180 (GRCm39) probably null Het
Scarb2 A G 5: 92,608,695 (GRCm39) L177P probably damaging Het
Sh3pxd2b A T 11: 32,372,203 (GRCm39) N457Y possibly damaging Het
Siae T A 9: 37,542,902 (GRCm39) probably null Het
Slc36a1 T C 11: 55,119,150 (GRCm39) L375P probably damaging Het
Smg8 A G 11: 86,976,594 (GRCm39) V329A probably damaging Het
Tas2r113 A T 6: 132,870,695 (GRCm39) Y241F probably damaging Het
Tm9sf3 T G 19: 41,244,668 (GRCm39) S70R probably benign Het
Tmem144 C T 3: 79,732,594 (GRCm39) S228N probably damaging Het
Tmem45a C A 16: 56,642,701 (GRCm39) V157F possibly damaging Het
Tpbg G T 9: 85,726,429 (GRCm39) V133L probably damaging Het
Trpv3 G A 11: 73,186,209 (GRCm39) V667I possibly damaging Het
Ube2c T C 2: 164,613,241 (GRCm39) F53S probably damaging Het
Vmn1r78 T A 7: 11,887,250 (GRCm39) V287D probably damaging Het
Vmn2r114 T A 17: 23,527,035 (GRCm39) D499V probably benign Het
Zpld2 C G 4: 133,927,610 (GRCm39) C381S probably damaging Het
Zpld2 T A 4: 133,929,430 (GRCm39) T292S possibly damaging Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7453:Cr2 UTSW 1 194,847,565 (GRCm39) splice site probably null
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGCCTGTGTGACCACCATTTGC -3'
(R):5'- CTCTGTGCCAAGGGGCTCATTTAG -3'

Sequencing Primer
(F):5'- GTGACCACCATTTGCAATTTTTGG -3'
(R):5'- GCCAAGGGGCTCATTTAGAAATATC -3'
Posted On 2014-05-23