Incidental Mutation 'R1748:Rif1'
ID 194093
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Name replication timing regulatory factor 1
Synonyms D2Ertd145e, 6530403D07Rik, 5730435J01Rik
MMRRC Submission 039780-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1748 (G1)
Quality Score 217
Status Not validated
Chromosome 2
Chromosomal Location 51962844-52012395 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) GCCACCA to GCCA at 52000336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000069794
AA Change: 1264
SMART Domains Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: 1264

DomainStartEndE-ValueType
Pfam:Rif1_N 22 368 3.3e-78 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112693
AA Change: P1264
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: P1264

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125322
Predicted Effect probably benign
Transcript: ENSMUST00000125376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145130
Predicted Effect probably benign
Transcript: ENSMUST00000152178
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,152,338 (GRCm39) Q1403K probably benign Het
Adamts12 G A 15: 11,241,548 (GRCm39) M373I probably damaging Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Aire T C 10: 77,879,314 (GRCm39) H15R probably damaging Het
Aldh3b2 T C 19: 4,027,572 (GRCm39) F38L probably damaging Het
Alk A C 17: 72,910,416 (GRCm39) C97G probably benign Het
Ano8 T C 8: 71,931,602 (GRCm39) probably benign Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arsk T A 13: 76,210,529 (GRCm39) H506L probably benign Het
Asgr2 G T 11: 69,987,658 (GRCm39) R52L probably damaging Het
Atp2a1 A G 7: 126,058,780 (GRCm39) I145T possibly damaging Het
Atrnl1 A G 19: 57,703,134 (GRCm39) T1051A probably damaging Het
Cacna1e A T 1: 154,362,315 (GRCm39) V424D possibly damaging Het
Capn3 T C 2: 120,327,494 (GRCm39) V574A probably benign Het
Capzb C A 4: 138,984,679 (GRCm39) D67E probably damaging Het
Ccdc68 A T 18: 70,089,062 (GRCm39) T202S probably benign Het
Ccser2 T C 14: 36,618,270 (GRCm39) K123R probably damaging Het
Ccser2 T A 14: 36,618,271 (GRCm39) K123* probably null Het
Ces2h T C 8: 105,744,473 (GRCm39) I316T probably benign Het
Chd3 T G 11: 69,255,523 (GRCm39) K122Q possibly damaging Het
Col12a1 T C 9: 79,580,279 (GRCm39) T1533A probably benign Het
Cr2 T A 1: 194,838,213 (GRCm39) K1084* probably null Het
Ddx28 A G 8: 106,737,314 (GRCm39) L248P probably benign Het
Depdc5 A G 5: 33,075,286 (GRCm39) E488G probably benign Het
Dld T C 12: 31,384,745 (GRCm39) T305A probably benign Het
Dok5 T A 2: 170,683,373 (GRCm39) F211L probably damaging Het
Duox2 T C 2: 122,117,532 (GRCm39) D934G probably benign Het
Eif3a G A 19: 60,755,236 (GRCm39) T982I unknown Het
Erbb2 G T 11: 98,326,161 (GRCm39) R979L probably benign Het
Espl1 G T 15: 102,206,964 (GRCm39) V143L possibly damaging Het
Fanci T C 7: 79,080,236 (GRCm39) L598P probably damaging Het
Fat2 T A 11: 55,147,473 (GRCm39) E3923V probably damaging Het
Fhod3 A T 18: 24,903,550 (GRCm39) K95* probably null Het
Gpr108 G T 17: 57,543,217 (GRCm39) T484K probably damaging Het
Hao1 T A 2: 134,340,238 (GRCm39) N351I possibly damaging Het
Hepacam A T 9: 37,295,189 (GRCm39) N308I possibly damaging Het
Herc2 T C 7: 55,798,571 (GRCm39) probably null Het
Hltf T C 3: 20,130,685 (GRCm39) I301T probably benign Het
Igsf10 A T 3: 59,226,514 (GRCm39) N2386K probably damaging Het
Ikbke G T 1: 131,186,937 (GRCm39) T585K probably benign Het
Iqgap3 A G 3: 88,021,287 (GRCm39) T448A possibly damaging Het
Kl T C 5: 150,904,450 (GRCm39) S401P possibly damaging Het
Lama4 T C 10: 38,941,615 (GRCm39) V684A probably benign Het
Lgals8 A T 13: 12,469,824 (GRCm39) F45Y probably damaging Het
Lgalsl G A 11: 20,776,491 (GRCm39) R134C probably benign Het
Lmcd1 T C 6: 112,306,875 (GRCm39) V349A probably benign Het
Lrp1b T A 2: 41,618,718 (GRCm39) N119Y possibly damaging Het
Lrrc73 T A 17: 46,566,621 (GRCm39) I157N probably damaging Het
Map3k8 A G 18: 4,334,766 (GRCm39) Y293H probably damaging Het
Mybphl A T 3: 108,282,400 (GRCm39) probably null Het
Naa12 T C 18: 80,255,161 (GRCm39) S152P probably benign Het
Ndrg1 A G 15: 66,802,930 (GRCm39) M140T possibly damaging Het
Or2n1e T A 17: 38,585,997 (GRCm39) C112S possibly damaging Het
Or8b38 A G 9: 37,972,796 (GRCm39) Y60C probably damaging Het
Pbx2 T C 17: 34,812,951 (GRCm39) S76P possibly damaging Het
Plcl2 T A 17: 50,913,826 (GRCm39) S278R probably benign Het
Polr3d A T 14: 70,676,915 (GRCm39) L393* probably null Het
Prmt6 T C 3: 110,157,683 (GRCm39) Q202R probably benign Het
Sag T A 1: 87,759,662 (GRCm39) I300N probably damaging Het
Sap25 T A 5: 137,640,180 (GRCm39) probably null Het
Scarb2 A G 5: 92,608,695 (GRCm39) L177P probably damaging Het
Sh3pxd2b A T 11: 32,372,203 (GRCm39) N457Y possibly damaging Het
Siae T A 9: 37,542,902 (GRCm39) probably null Het
Slc36a1 T C 11: 55,119,150 (GRCm39) L375P probably damaging Het
Smg8 A G 11: 86,976,594 (GRCm39) V329A probably damaging Het
Tas2r113 A T 6: 132,870,695 (GRCm39) Y241F probably damaging Het
Tm9sf3 T G 19: 41,244,668 (GRCm39) S70R probably benign Het
Tmem144 C T 3: 79,732,594 (GRCm39) S228N probably damaging Het
Tmem45a C A 16: 56,642,701 (GRCm39) V157F possibly damaging Het
Tpbg G T 9: 85,726,429 (GRCm39) V133L probably damaging Het
Trpv3 G A 11: 73,186,209 (GRCm39) V667I possibly damaging Het
Ube2c T C 2: 164,613,241 (GRCm39) F53S probably damaging Het
Vmn1r78 T A 7: 11,887,250 (GRCm39) V287D probably damaging Het
Vmn2r114 T A 17: 23,527,035 (GRCm39) D499V probably benign Het
Zpld2 C G 4: 133,927,610 (GRCm39) C381S probably damaging Het
Zpld2 T A 4: 133,929,430 (GRCm39) T292S possibly damaging Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52,011,019 (GRCm39) missense probably damaging 0.96
IGL00711:Rif1 APN 2 52,001,082 (GRCm39) missense probably benign 0.00
IGL00721:Rif1 APN 2 52,009,129 (GRCm39) missense probably damaging 1.00
IGL01085:Rif1 APN 2 51,975,152 (GRCm39) missense possibly damaging 0.71
IGL01093:Rif1 APN 2 51,985,960 (GRCm39) missense probably damaging 1.00
IGL01107:Rif1 APN 2 52,001,315 (GRCm39) missense probably benign 0.00
IGL01138:Rif1 APN 2 52,001,534 (GRCm39) missense probably damaging 1.00
IGL01844:Rif1 APN 2 52,002,555 (GRCm39) missense probably benign 0.07
IGL02441:Rif1 APN 2 51,995,527 (GRCm39) missense probably benign 0.00
IGL02448:Rif1 APN 2 52,006,708 (GRCm39) missense probably damaging 0.99
IGL02563:Rif1 APN 2 51,967,077 (GRCm39) missense probably damaging 1.00
IGL02704:Rif1 APN 2 51,983,588 (GRCm39) missense probably damaging 1.00
IGL02946:Rif1 APN 2 52,000,137 (GRCm39) nonsense probably null
IGL03060:Rif1 APN 2 52,002,149 (GRCm39) missense probably damaging 0.97
IGL03206:Rif1 APN 2 51,993,634 (GRCm39) missense probably damaging 1.00
IGL03263:Rif1 APN 2 51,980,273 (GRCm39) missense probably damaging 0.99
IGL03267:Rif1 APN 2 51,967,000 (GRCm39) missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52,002,611 (GRCm39) missense probably benign 0.32
hifi UTSW 2 52,000,336 (GRCm39) unclassified probably benign
nietzsche UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52,001,970 (GRCm39) missense
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0017:Rif1 UTSW 2 52,006,686 (GRCm39) missense probably benign 0.18
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0060:Rif1 UTSW 2 52,001,129 (GRCm39) missense probably damaging 1.00
R0104:Rif1 UTSW 2 52,000,104 (GRCm39) missense possibly damaging 0.77
R0268:Rif1 UTSW 2 51,980,298 (GRCm39) critical splice donor site probably null
R0276:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0278:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0288:Rif1 UTSW 2 52,000,025 (GRCm39) missense probably damaging 1.00
R0314:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0345:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0346:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0383:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R0384:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0387:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0388:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0456:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0477:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0505:Rif1 UTSW 2 52,000,749 (GRCm39) missense probably damaging 0.99
R0510:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0511:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0633:Rif1 UTSW 2 52,002,575 (GRCm39) missense probably benign 0.00
R0637:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0638:Rif1 UTSW 2 52,001,600 (GRCm39) missense probably benign 0.12
R0666:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0675:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0707:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0726:Rif1 UTSW 2 52,000,365 (GRCm39) missense possibly damaging 0.52
R0743:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0744:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0938:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0939:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0940:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0941:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0942:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R0943:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1006:Rif1 UTSW 2 51,975,041 (GRCm39) missense probably damaging 0.99
R1052:Rif1 UTSW 2 52,001,574 (GRCm39) missense probably benign 0.01
R1061:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1175:Rif1 UTSW 2 51,997,640 (GRCm39) unclassified probably benign
R1183:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1184:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1271:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1332:Rif1 UTSW 2 51,968,326 (GRCm39) missense probably benign 0.06
R1336:Rif1 UTSW 2 51,968,326 (GRCm39) missense probably benign 0.06
R1351:Rif1 UTSW 2 52,001,567 (GRCm39) missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1527:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1560:Rif1 UTSW 2 52,001,143 (GRCm39) missense probably damaging 1.00
R1563:Rif1 UTSW 2 51,963,235 (GRCm39) missense probably damaging 0.99
R1571:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1625:Rif1 UTSW 2 51,993,652 (GRCm39) missense probably benign 0.25
R1679:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1689:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1731:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1744:Rif1 UTSW 2 52,002,404 (GRCm39) missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R1831:Rif1 UTSW 2 51,968,507 (GRCm39) nonsense probably null
R1902:Rif1 UTSW 2 52,006,685 (GRCm39) missense possibly damaging 0.93
R1964:Rif1 UTSW 2 51,988,421 (GRCm39) missense probably benign 0.01
R1978:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2000:Rif1 UTSW 2 51,971,310 (GRCm39) missense probably damaging 0.99
R2030:Rif1 UTSW 2 51,982,358 (GRCm39) missense probably damaging 1.00
R2056:Rif1 UTSW 2 51,983,588 (GRCm39) missense probably damaging 1.00
R2106:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2109:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2125:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2126:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2145:Rif1 UTSW 2 52,001,412 (GRCm39) missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2153:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2213:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2327:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2512:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2513:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2516:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2520:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R2905:Rif1 UTSW 2 51,988,516 (GRCm39) missense probably damaging 0.99
R3005:Rif1 UTSW 2 51,972,776 (GRCm39) missense probably damaging 1.00
R3155:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3156:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3429:Rif1 UTSW 2 52,000,336 (GRCm39) unclassified probably benign
R3707:Rif1 UTSW 2 51,983,592 (GRCm39) missense probably damaging 1.00
R3907:Rif1 UTSW 2 52,002,557 (GRCm39) missense probably benign 0.03
R3978:Rif1 UTSW 2 52,006,759 (GRCm39) critical splice donor site probably null
R4023:Rif1 UTSW 2 52,011,099 (GRCm39) missense probably benign 0.01
R4052:Rif1 UTSW 2 51,988,483 (GRCm39) nonsense probably null
R4668:Rif1 UTSW 2 52,001,964 (GRCm39) missense probably benign 0.01
R4674:Rif1 UTSW 2 51,996,954 (GRCm39) missense probably null 1.00
R4715:Rif1 UTSW 2 51,963,151 (GRCm39) utr 5 prime probably benign
R4766:Rif1 UTSW 2 51,988,946 (GRCm39) missense probably damaging 1.00
R4783:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4785:Rif1 UTSW 2 52,002,759 (GRCm39) missense probably damaging 0.96
R4869:Rif1 UTSW 2 51,983,623 (GRCm39) intron probably benign
R4911:Rif1 UTSW 2 52,000,530 (GRCm39) missense probably damaging 0.98
R4951:Rif1 UTSW 2 51,974,998 (GRCm39) splice site probably null
R5044:Rif1 UTSW 2 51,999,940 (GRCm39) missense probably damaging 0.99
R5088:Rif1 UTSW 2 51,982,307 (GRCm39) missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52,010,321 (GRCm39) missense probably damaging 1.00
R5187:Rif1 UTSW 2 51,971,301 (GRCm39) missense probably damaging 1.00
R5222:Rif1 UTSW 2 51,967,032 (GRCm39) missense probably benign 0.08
R5243:Rif1 UTSW 2 52,001,836 (GRCm39) missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52,010,983 (GRCm39) intron probably benign
R5476:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
R5496:Rif1 UTSW 2 51,988,928 (GRCm39) missense probably damaging 1.00
R5641:Rif1 UTSW 2 52,011,170 (GRCm39) missense possibly damaging 0.80
R5883:Rif1 UTSW 2 51,995,651 (GRCm39) critical splice donor site probably null
R5987:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5990:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R5992:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6019:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6020:Rif1 UTSW 2 51,985,856 (GRCm39) missense probably damaging 1.00
R6255:Rif1 UTSW 2 51,975,065 (GRCm39) missense probably damaging 1.00
R6342:Rif1 UTSW 2 52,009,168 (GRCm39) missense probably damaging 0.97
R6364:Rif1 UTSW 2 51,997,681 (GRCm39) missense probably damaging 0.97
R6747:Rif1 UTSW 2 51,968,275 (GRCm39) splice site probably null
R6928:Rif1 UTSW 2 51,985,973 (GRCm39) missense probably damaging 1.00
R6954:Rif1 UTSW 2 52,002,703 (GRCm39) missense probably benign 0.00
R7003:Rif1 UTSW 2 51,967,001 (GRCm39) missense probably benign 0.06
R7310:Rif1 UTSW 2 51,995,631 (GRCm39) missense probably benign 0.12
R7549:Rif1 UTSW 2 51,968,519 (GRCm39) missense possibly damaging 0.52
R7603:Rif1 UTSW 2 51,966,187 (GRCm39) missense probably damaging 1.00
R7673:Rif1 UTSW 2 51,978,666 (GRCm39) missense probably damaging 1.00
R7741:Rif1 UTSW 2 51,975,153 (GRCm39) missense probably damaging 0.96
R7777:Rif1 UTSW 2 52,006,368 (GRCm39) missense probably benign 0.00
R7910:Rif1 UTSW 2 51,968,399 (GRCm39) nonsense probably null
R7962:Rif1 UTSW 2 51,964,288 (GRCm39) missense probably damaging 1.00
R8264:Rif1 UTSW 2 51,980,290 (GRCm39) missense noncoding transcript
R8390:Rif1 UTSW 2 52,000,935 (GRCm39) missense probably damaging 1.00
R8479:Rif1 UTSW 2 52,002,563 (GRCm39) missense possibly damaging 0.52
R8490:Rif1 UTSW 2 52,001,011 (GRCm39) missense probably damaging 0.96
R8762:Rif1 UTSW 2 52,001,742 (GRCm39) missense
R8785:Rif1 UTSW 2 52,000,493 (GRCm39) missense probably benign 0.06
R8890:Rif1 UTSW 2 51,988,875 (GRCm39) missense probably damaging 0.99
R9081:Rif1 UTSW 2 52,000,989 (GRCm39) missense probably damaging 0.99
R9225:Rif1 UTSW 2 52,001,862 (GRCm39) missense probably benign 0.22
R9284:Rif1 UTSW 2 51,998,564 (GRCm39) missense probably benign 0.00
R9300:Rif1 UTSW 2 52,001,151 (GRCm39) missense probably damaging 1.00
R9366:Rif1 UTSW 2 52,010,356 (GRCm39) missense
R9477:Rif1 UTSW 2 52,001,342 (GRCm39) missense probably benign 0.02
R9522:Rif1 UTSW 2 51,971,311 (GRCm39) missense probably damaging 1.00
R9573:Rif1 UTSW 2 52,000,466 (GRCm39) missense probably benign 0.29
R9630:Rif1 UTSW 2 51,979,607 (GRCm39) missense probably damaging 1.00
X0064:Rif1 UTSW 2 51,984,645 (GRCm39) missense probably damaging 0.96
X0064:Rif1 UTSW 2 51,964,327 (GRCm39) missense probably benign 0.00
Z1177:Rif1 UTSW 2 51,978,660 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCTGTTGCTGAAACCAATCC -3'
(R):5'- TGTTCTGTTCGTGCTACAACTGAGG -3'

Sequencing Primer
(F):5'- CTAGTACAGAAACTTCGGTGGTC -3'
(R):5'- GCTACAACTGAGGCTGTACTTTC -3'
Posted On 2014-05-23