Incidental Mutation 'R1748:Herc2'
Institutional Source Beutler Lab
Gene Symbol Herc2
Ensembl Gene ENSMUSG00000030451
Gene NameHECT and RLD domain containing E3 ubiquitin protein ligase 2
SynonymsD7H15F37S1, D7H15F32S1, rjs, jdf2, D15F32S1h
MMRRC Submission 039780-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.931) question?
Stock #R1748 (G1)
Quality Score225
Status Not validated
Chromosomal Location56050196-56231800 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 56148823 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076226] [ENSMUST00000164095] [ENSMUST00000205303]
Predicted Effect probably null
Transcript: ENSMUST00000076226
SMART Domains Protein: ENSMUSP00000075579
Gene: ENSMUSG00000030451

low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 7.6e-16 PFAM
Pfam:RCC1_2 554 583 6e-9 PFAM
Pfam:RCC1 570 615 7.1e-17 PFAM
Pfam:RCC1_2 606 637 6.9e-8 PFAM
Pfam:RCC1 624 673 7.2e-15 PFAM
Pfam:RCC1 676 725 3.3e-18 PFAM
Pfam:RCC1_2 712 740 1.6e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1933 5.8e-29 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2633 2.6e-43 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 9.2e-8 PFAM
Pfam:RCC1 3066 3115 3.7e-17 PFAM
Pfam:RCC1_2 3102 3131 3.9e-11 PFAM
Pfam:RCC1 3118 3162 1.9e-15 PFAM
Pfam:RCC1 3172 3221 9.6e-15 PFAM
Pfam:RCC1_2 3208 3236 2.2e-7 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 5.1e-8 PFAM
Pfam:RCC1 4059 4108 1.5e-16 PFAM
Pfam:RCC1 4111 4155 7.9e-16 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 4.3e-10 PFAM
Pfam:RCC1 4269 4318 1.2e-17 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164095
SMART Domains Protein: ENSMUSP00000131573
Gene: ENSMUSG00000030451

low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 2.9e-15 PFAM
Pfam:RCC1_2 554 583 1.6e-8 PFAM
Pfam:RCC1 570 615 2.3e-16 PFAM
Pfam:RCC1 624 673 1.2e-14 PFAM
Pfam:RCC1_2 660 689 2.1e-7 PFAM
Pfam:RCC1 676 725 9.8e-18 PFAM
Pfam:RCC1_2 712 740 1.1e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1931 9.3e-25 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2632 1.4e-39 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 1.6e-7 PFAM
Pfam:RCC1 3066 3115 7.1e-16 PFAM
Pfam:RCC1_2 3102 3131 7.1e-11 PFAM
Pfam:RCC1 3118 3163 1.2e-14 PFAM
Pfam:RCC1 3172 3221 4.7e-15 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 1.2e-7 PFAM
Pfam:RCC1 4059 4108 9.6e-15 PFAM
Pfam:RCC1 4111 4156 5.6e-15 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 7.3e-10 PFAM
Pfam:RCC1 4269 4318 1.6e-16 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000205303
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for null mutations exhibit runting, nervousness, and incoordination. Males are sterile with sperm abnormalities, while females show reduced fertility and impaired maternal ability. Also see alleles at the Oca2 (p) locus for deletions that encompass the Herc2 gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,333,588 Q1403K probably benign Het
Adamts12 G A 15: 11,241,462 M373I probably damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aire T C 10: 78,043,480 H15R probably damaging Het
Aldh3b2 T C 19: 3,977,572 F38L probably damaging Het
Alk A C 17: 72,603,421 C97G probably benign Het
Ano8 T C 8: 71,478,958 probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arsk T A 13: 76,062,410 H506L probably benign Het
Asgr2 G T 11: 70,096,832 R52L probably damaging Het
Atp2a1 A G 7: 126,459,608 I145T possibly damaging Het
Atrnl1 A G 19: 57,714,702 T1051A probably damaging Het
Cacna1e A T 1: 154,486,569 V424D possibly damaging Het
Capn3 T C 2: 120,497,013 V574A probably benign Het
Capzb C A 4: 139,257,368 D67E probably damaging Het
Ccdc68 A T 18: 69,955,991 T202S probably benign Het
Ccser2 T A 14: 36,896,314 K123* probably null Het
Ccser2 T C 14: 36,896,313 K123R probably damaging Het
Ces2h T C 8: 105,017,841 I316T probably benign Het
Chd3 T G 11: 69,364,697 K122Q possibly damaging Het
Col12a1 T C 9: 79,672,997 T1533A probably benign Het
Cr2 T A 1: 195,155,905 K1084* probably null Het
Ddx28 A G 8: 106,010,682 L248P probably benign Het
Depdc5 A G 5: 32,917,942 E488G probably benign Het
Dld T C 12: 31,334,746 T305A probably benign Het
Dok5 T A 2: 170,841,453 F211L probably damaging Het
Duox2 T C 2: 122,287,051 D934G probably benign Het
Eif3a G A 19: 60,766,798 T982I unknown Het
Erbb2 G T 11: 98,435,335 R979L probably benign Het
Espl1 G T 15: 102,298,529 V143L possibly damaging Het
Fanci T C 7: 79,430,488 L598P probably damaging Het
Fat2 T A 11: 55,256,647 E3923V probably damaging Het
Fhod3 A T 18: 24,770,493 K95* probably null Het
Gm16286 T C 18: 80,211,946 S152P probably benign Het
Gm7534 C G 4: 134,200,299 C381S probably damaging Het
Gm7534 T A 4: 134,202,119 T292S possibly damaging Het
Gpr108 G T 17: 57,236,217 T484K probably damaging Het
Hao1 T A 2: 134,498,318 N351I possibly damaging Het
Hepacam A T 9: 37,383,893 N308I possibly damaging Het
Hltf T C 3: 20,076,521 I301T probably benign Het
Igsf10 A T 3: 59,319,093 N2386K probably damaging Het
Ikbke G T 1: 131,259,200 T585K probably benign Het
Iqgap3 A G 3: 88,113,980 T448A possibly damaging Het
Kl T C 5: 150,980,985 S401P possibly damaging Het
Lama4 T C 10: 39,065,619 V684A probably benign Het
Lgals8 A T 13: 12,454,943 F45Y probably damaging Het
Lgalsl G A 11: 20,826,491 R134C probably benign Het
Lmcd1 T C 6: 112,329,914 V349A probably benign Het
Lrp1b T A 2: 41,728,706 N119Y possibly damaging Het
Lrrc73 T A 17: 46,255,695 I157N probably damaging Het
Map3k8 A G 18: 4,334,766 Y293H probably damaging Het
Mybphl A T 3: 108,375,084 probably null Het
Ndrg1 A G 15: 66,931,081 M140T possibly damaging Het
Olfr138 T A 17: 38,275,106 C112S possibly damaging Het
Olfr885 A G 9: 38,061,500 Y60C probably damaging Het
Pbx2 T C 17: 34,593,977 S76P possibly damaging Het
Plcl2 T A 17: 50,606,798 S278R probably benign Het
Polr3d A T 14: 70,439,475 L393* probably null Het
Prmt6 T C 3: 110,250,367 Q202R probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sag T A 1: 87,831,940 I300N probably damaging Het
Sap25 T A 5: 137,641,918 probably null Het
Scarb2 A G 5: 92,460,836 L177P probably damaging Het
Sh3pxd2b A T 11: 32,422,203 N457Y possibly damaging Het
Siae T A 9: 37,631,606 probably null Het
Slc36a1 T C 11: 55,228,324 L375P probably damaging Het
Smg8 A G 11: 87,085,768 V329A probably damaging Het
Tas2r113 A T 6: 132,893,732 Y241F probably damaging Het
Tm9sf3 T G 19: 41,256,229 S70R probably benign Het
Tmem144 C T 3: 79,825,287 S228N probably damaging Het
Tmem45a C A 16: 56,822,338 V157F possibly damaging Het
Tpbg G T 9: 85,844,376 V133L probably damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ube2c T C 2: 164,771,321 F53S probably damaging Het
Vmn1r78 T A 7: 12,153,323 V287D probably damaging Het
Vmn2r114 T A 17: 23,308,061 D499V probably benign Het
Other mutations in Herc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Herc2 APN 7 56124299 missense probably damaging 1.00
IGL00529:Herc2 APN 7 56157753 missense probably benign
IGL00548:Herc2 APN 7 56206565 missense probably benign 0.20
IGL00970:Herc2 APN 7 56181064 splice site probably benign
IGL01141:Herc2 APN 7 56212841 missense possibly damaging 0.47
IGL01147:Herc2 APN 7 56156949 missense probably benign 0.43
IGL01150:Herc2 APN 7 56181133 missense probably damaging 1.00
IGL01519:Herc2 APN 7 56103950 missense probably damaging 1.00
IGL01576:Herc2 APN 7 56226661 critical splice donor site probably null
IGL01626:Herc2 APN 7 56085142 missense probably benign 0.02
IGL01658:Herc2 APN 7 56159452 missense probably damaging 1.00
IGL01707:Herc2 APN 7 56165187 missense probably damaging 1.00
IGL01727:Herc2 APN 7 56137806 missense probably damaging 1.00
IGL01935:Herc2 APN 7 56153793 missense probably benign
IGL01969:Herc2 APN 7 56185831 splice site probably benign
IGL02074:Herc2 APN 7 56087444 splice site probably benign
IGL02261:Herc2 APN 7 56206744 missense probably damaging 0.99
IGL02339:Herc2 APN 7 56121722 missense probably benign 0.01
IGL02353:Herc2 APN 7 56114812 missense probably damaging 1.00
IGL02360:Herc2 APN 7 56114812 missense probably damaging 1.00
IGL02409:Herc2 APN 7 56220469 splice site probably null
IGL02528:Herc2 APN 7 56108893 splice site probably benign
IGL02571:Herc2 APN 7 56153386 missense probably damaging 1.00
IGL02578:Herc2 APN 7 56106535 splice site probably null
IGL02661:Herc2 APN 7 56113073 missense probably damaging 1.00
IGL02664:Herc2 APN 7 56135678 nonsense probably null
IGL02675:Herc2 APN 7 56164101 missense probably damaging 0.99
IGL02689:Herc2 APN 7 56165283 splice site probably benign
IGL02710:Herc2 APN 7 56137814 missense possibly damaging 0.95
IGL02750:Herc2 APN 7 56204379 splice site probably benign
IGL02754:Herc2 APN 7 56097498 missense probably damaging 1.00
IGL03029:Herc2 APN 7 56168967 missense probably damaging 1.00
IGL03039:Herc2 APN 7 56169021 splice site probably benign
IGL03082:Herc2 APN 7 56185923 missense probably benign 0.19
IGL03090:Herc2 APN 7 56204473 missense probably damaging 0.96
IGL03154:Herc2 APN 7 56202159 missense probably damaging 1.00
IGL03165:Herc2 APN 7 56191912 missense probably damaging 1.00
IGL03201:Herc2 APN 7 56219768 missense probably damaging 1.00
IGL03234:Herc2 APN 7 56103862 missense probably damaging 1.00
IGL03293:Herc2 APN 7 56155130 missense probably benign 0.43
IGL03331:Herc2 APN 7 56135267 splice site probably benign
IGL03340:Herc2 APN 7 56090920 missense possibly damaging 0.51
IGL03409:Herc2 APN 7 56228569 missense probably damaging 1.00
alarmed UTSW 7 56229662 missense possibly damaging 0.92
hyper UTSW 7 56159417 missense probably damaging 1.00
uptight UTSW 7 56113210 missense probably damaging 1.00
I0000:Herc2 UTSW 7 56136729 splice site probably benign
PIT1430001:Herc2 UTSW 7 56226954 missense probably damaging 1.00
R0009:Herc2 UTSW 7 56207812 missense probably benign 0.03
R0009:Herc2 UTSW 7 56207812 missense probably benign 0.03
R0058:Herc2 UTSW 7 56170483 missense possibly damaging 0.93
R0114:Herc2 UTSW 7 56153774 splice site probably benign
R0117:Herc2 UTSW 7 56213611 splice site probably benign
R0141:Herc2 UTSW 7 56121561 missense probably benign 0.17
R0266:Herc2 UTSW 7 56206578 missense probably damaging 1.00
R0401:Herc2 UTSW 7 56157732 missense probably damaging 0.99
R0403:Herc2 UTSW 7 56159417 missense probably damaging 1.00
R0437:Herc2 UTSW 7 56219815 nonsense probably null
R0491:Herc2 UTSW 7 56122366 missense possibly damaging 0.54
R0499:Herc2 UTSW 7 56184369 nonsense probably null
R0580:Herc2 UTSW 7 56138791 missense probably damaging 1.00
R0650:Herc2 UTSW 7 56113210 missense probably damaging 1.00
R0744:Herc2 UTSW 7 56206036 splice site probably benign
R0798:Herc2 UTSW 7 56135683 critical splice donor site probably null
R0842:Herc2 UTSW 7 56121705 missense probably benign
R0849:Herc2 UTSW 7 56206578 missense probably damaging 1.00
R0850:Herc2 UTSW 7 56204483 missense probably benign 0.09
R0926:Herc2 UTSW 7 56132548 missense possibly damaging 0.67
R1146:Herc2 UTSW 7 56146696 missense probably benign
R1146:Herc2 UTSW 7 56146696 missense probably benign
R1292:Herc2 UTSW 7 56197203 missense probably benign 0.05
R1370:Herc2 UTSW 7 56168873 missense probably benign 0.01
R1443:Herc2 UTSW 7 56204733 missense possibly damaging 0.69
R1445:Herc2 UTSW 7 56168996 missense probably damaging 1.00
R1541:Herc2 UTSW 7 56135657 missense probably damaging 1.00
R1550:Herc2 UTSW 7 56135658 missense probably damaging 1.00
R1551:Herc2 UTSW 7 56146669 missense probably benign 0.01
R1633:Herc2 UTSW 7 56229369 missense probably null 1.00
R1635:Herc2 UTSW 7 56136667 missense probably benign 0.00
R1659:Herc2 UTSW 7 56135105 missense probably benign 0.00
R1682:Herc2 UTSW 7 56088400 missense possibly damaging 0.87
R1697:Herc2 UTSW 7 56153905 missense probably benign 0.43
R1802:Herc2 UTSW 7 56184332 missense probably damaging 1.00
R1835:Herc2 UTSW 7 56206765 nonsense probably null
R1836:Herc2 UTSW 7 56155105 nonsense probably null
R1872:Herc2 UTSW 7 56157509 missense probably benign 0.18
R1889:Herc2 UTSW 7 56189813 missense possibly damaging 0.60
R1906:Herc2 UTSW 7 56114864 missense probably benign 0.01
R2004:Herc2 UTSW 7 56137859 missense probably damaging 1.00
R2030:Herc2 UTSW 7 56184373 missense probably damaging 0.99
R2037:Herc2 UTSW 7 56205961 missense probably damaging 1.00
R2059:Herc2 UTSW 7 56163897 missense probably damaging 1.00
R2068:Herc2 UTSW 7 56132497 missense probably damaging 1.00
R2072:Herc2 UTSW 7 56226964 missense probably damaging 1.00
R2085:Herc2 UTSW 7 56212965 missense possibly damaging 0.94
R2115:Herc2 UTSW 7 56185828 splice site probably benign
R2160:Herc2 UTSW 7 56212922 missense probably benign 0.00
R2173:Herc2 UTSW 7 56185951 missense probably benign 0.27
R2221:Herc2 UTSW 7 56169018 critical splice donor site probably null
R2280:Herc2 UTSW 7 56137271 missense possibly damaging 0.79
R3078:Herc2 UTSW 7 56137243 missense probably benign
R3104:Herc2 UTSW 7 56135355 missense probably benign 0.23
R3177:Herc2 UTSW 7 56153428 missense probably benign 0.00
R3277:Herc2 UTSW 7 56153428 missense probably benign 0.00
R3766:Herc2 UTSW 7 56163824 missense probably damaging 1.00
R3770:Herc2 UTSW 7 56165007 missense probably benign
R3807:Herc2 UTSW 7 56207809 missense probably damaging 1.00
R3912:Herc2 UTSW 7 56098437 missense probably damaging 0.98
R4004:Herc2 UTSW 7 56106465 missense possibly damaging 0.53
R4039:Herc2 UTSW 7 56156411 missense probably damaging 0.98
R4190:Herc2 UTSW 7 56122448 missense probably benign 0.03
R4225:Herc2 UTSW 7 56164987 missense probably damaging 1.00
R4334:Herc2 UTSW 7 56226654 missense probably damaging 1.00
R4405:Herc2 UTSW 7 56170477 missense probably damaging 1.00
R4448:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4450:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4565:Herc2 UTSW 7 56153838 missense possibly damaging 0.71
R4667:Herc2 UTSW 7 56131253 missense probably damaging 1.00
R4747:Herc2 UTSW 7 56106393 missense possibly damaging 0.80
R4762:Herc2 UTSW 7 56170640 missense probably benign 0.19
R4829:Herc2 UTSW 7 56106492 missense probably benign 0.39
R4832:Herc2 UTSW 7 56098417 nonsense probably null
R4895:Herc2 UTSW 7 56222986 missense probably damaging 1.00
R4904:Herc2 UTSW 7 56157486 missense probably damaging 0.99
R4908:Herc2 UTSW 7 56177912 missense probably benign 0.01
R4911:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4921:Herc2 UTSW 7 56229690 missense probably benign 0.04
R4939:Herc2 UTSW 7 56206736 missense probably damaging 1.00
R5155:Herc2 UTSW 7 56227826 missense possibly damaging 0.85
R5184:Herc2 UTSW 7 56122351 missense probably damaging 1.00
R5269:Herc2 UTSW 7 56168870 nonsense probably null
R5306:Herc2 UTSW 7 56184961 missense probably damaging 1.00
R5314:Herc2 UTSW 7 56219786 missense probably damaging 0.99
R5369:Herc2 UTSW 7 56182700 missense probably damaging 1.00
R5418:Herc2 UTSW 7 56137565 missense probably damaging 1.00
R5420:Herc2 UTSW 7 56203830 missense probably damaging 0.96
R5463:Herc2 UTSW 7 56194262 missense probably damaging 1.00
R5510:Herc2 UTSW 7 56206771 missense probably damaging 1.00
R5634:Herc2 UTSW 7 56206783 missense probably damaging 1.00
R5638:Herc2 UTSW 7 56204416 missense probably benign 0.01
R5690:Herc2 UTSW 7 56157705 missense probably benign
R5762:Herc2 UTSW 7 56197190 missense possibly damaging 0.68
R5807:Herc2 UTSW 7 56230919 missense probably damaging 0.99
R5878:Herc2 UTSW 7 56124248 missense probably benign
R6036:Herc2 UTSW 7 56068053 missense probably benign 0.01
R6036:Herc2 UTSW 7 56068053 missense probably benign 0.01
R6083:Herc2 UTSW 7 56228505 missense probably benign 0.00
R6192:Herc2 UTSW 7 56207762 missense probably damaging 1.00
R6193:Herc2 UTSW 7 56156901 missense probably damaging 0.98
R6261:Herc2 UTSW 7 56197072 nonsense probably null
R6267:Herc2 UTSW 7 56153166 nonsense probably null
R6267:Herc2 UTSW 7 56204718 missense possibly damaging 0.51
R6298:Herc2 UTSW 7 56191265 missense probably benign
R6299:Herc2 UTSW 7 56135055 missense possibly damaging 0.86
R6326:Herc2 UTSW 7 56222934 missense probably damaging 0.98
R6347:Herc2 UTSW 7 56194403 critical splice donor site probably null
R6394:Herc2 UTSW 7 56215981 missense probably damaging 1.00
R6500:Herc2 UTSW 7 56146645 nonsense probably null
R6526:Herc2 UTSW 7 56157330 missense probably damaging 0.99
R6592:Herc2 UTSW 7 56207690 critical splice acceptor site probably null
R6619:Herc2 UTSW 7 56068092 nonsense probably null
R6719:Herc2 UTSW 7 56212826 missense probably damaging 1.00
R6750:Herc2 UTSW 7 56097447 missense probably damaging 1.00
R6807:Herc2 UTSW 7 56164922 missense probably damaging 1.00
R6811:Herc2 UTSW 7 56113433 nonsense probably null
R6837:Herc2 UTSW 7 56189841 missense possibly damaging 0.89
R6838:Herc2 UTSW 7 56108778 missense probably damaging 1.00
R6902:Herc2 UTSW 7 56135486 missense probably benign 0.37
R6983:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6985:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6985:Herc2 UTSW 7 56132480 missense probably damaging 1.00
R6986:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6987:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R7113:Herc2 UTSW 7 56203849 missense probably damaging 0.99
R7173:Herc2 UTSW 7 56203827 missense probably damaging 1.00
R7202:Herc2 UTSW 7 56131286 missense probably damaging 0.99
R7205:Herc2 UTSW 7 56182640 missense probably damaging 1.00
R7236:Herc2 UTSW 7 56085080 missense probably benign 0.29
R7297:Herc2 UTSW 7 56136658 missense probably benign 0.00
R7358:Herc2 UTSW 7 56182675 missense possibly damaging 0.48
R7438:Herc2 UTSW 7 56103718 splice site probably null
R7537:Herc2 UTSW 7 56219779 nonsense probably null
R7578:Herc2 UTSW 7 56134800 missense probably benign 0.07
R7614:Herc2 UTSW 7 56153275 nonsense probably null
R7638:Herc2 UTSW 7 56157438 missense probably benign 0.26
R7638:Herc2 UTSW 7 56220525 missense probably damaging 1.00
R7646:Herc2 UTSW 7 56134613 missense probably benign
R7663:Herc2 UTSW 7 56136685 missense probably benign
R7665:Herc2 UTSW 7 56153155 missense probably damaging 1.00
R7691:Herc2 UTSW 7 56191845 missense probably benign
R7733:Herc2 UTSW 7 56188664 missense probably damaging 0.99
R7767:Herc2 UTSW 7 56228527 missense probably benign 0.39
R7802:Herc2 UTSW 7 56164090 missense probably damaging 1.00
R7847:Herc2 UTSW 7 56157560 critical splice donor site probably null
R7956:Herc2 UTSW 7 56113400 missense probably damaging 0.97
R7985:Herc2 UTSW 7 56165244 missense probably benign
R8003:Herc2 UTSW 7 56168904 missense possibly damaging 0.94
R8045:Herc2 UTSW 7 56184900 missense probably damaging 1.00
R8085:Herc2 UTSW 7 56229679 missense probably benign 0.01
R8134:Herc2 UTSW 7 56085136 missense probably benign 0.10
R8259:Herc2 UTSW 7 56205890 missense probably damaging 0.99
R8286:Herc2 UTSW 7 56229662 missense possibly damaging 0.92
R8304:Herc2 UTSW 7 56159438 missense probably damaging 1.00
R8321:Herc2 UTSW 7 56229348 missense possibly damaging 0.84
R8332:Herc2 UTSW 7 56146595 missense probably damaging 1.00
R8432:Herc2 UTSW 7 56155112 missense probably benign 0.14
R8516:Herc2 UTSW 7 56206570 missense probably benign 0.05
RF024:Herc2 UTSW 7 56226525 missense probably damaging 1.00
X0011:Herc2 UTSW 7 56131292 missense probably benign
X0023:Herc2 UTSW 7 56090918 missense possibly damaging 0.73
X0057:Herc2 UTSW 7 56229690 missense probably benign 0.04
X0064:Herc2 UTSW 7 56191211 missense probably benign 0.01
X0064:Herc2 UTSW 7 56191258 missense probably benign
Z1088:Herc2 UTSW 7 56131292 missense probably benign
Z1088:Herc2 UTSW 7 56215381 missense possibly damaging 0.86
Z1088:Herc2 UTSW 7 56215432 missense probably damaging 1.00
Z1088:Herc2 UTSW 7 56226589 missense probably damaging 1.00
Z1088:Herc2 UTSW 7 56087341 missense probably benign 0.00
Z1176:Herc2 UTSW 7 56097533 missense possibly damaging 0.48
Z1176:Herc2 UTSW 7 56131292 missense probably benign
Z1176:Herc2 UTSW 7 56132498 missense probably damaging 1.00
Z1177:Herc2 UTSW 7 56121589 missense possibly damaging 0.55
Z1177:Herc2 UTSW 7 56131292 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gttgatgtgacgaaaattgcc -3'
Posted On2014-05-23