Mutagenetix > Incidental Mutation

Incidental Mutation 'R1748:Anpep'

194119

Institutional Source

Beutler Lab

Gene Symbol

Anpep

Ensembl Gene

ENSMUSG00000039062

Gene Name

alanyl (membrane) aminopeptidase

Synonyms

aminopeptidase N, Cd13, Apn

MMRRC Submission

039780-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1748 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

79821803-79861059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 79838256 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 518 (E518K)

Ref Sequence

ENSEMBL: ENSMUSP00000103015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502] [ENSMUST00000206235]

AlphaFold

P97449

Predicted Effect

probably benign
Transcript: ENSMUST00000049004
AA Change: E518K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: E518K

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	6.3e-142	PFAM
Pfam:Peptidase_MA_2	355	502	1.4e-21	PFAM
Pfam:ERAP1_C	618	944	2.9e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000107392
AA Change: E518K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: E518K

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	2.5e-139	PFAM
Pfam:ERAP1_C	618	943	2e-73	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149164

Predicted Effect

probably benign
Transcript: ENSMUST00000205502

Predicted Effect

probably benign
Transcript: ENSMUST00000206235

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	T	16: 20,333,588	Q1403K	probably benign	Het
Adamts12	G	A	15: 11,241,462	M373I	probably damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Aire	T	C	10: 78,043,480	H15R	probably damaging	Het
Aldh3b2	T	C	19: 3,977,572	F38L	probably damaging	Het
Alk	A	C	17: 72,603,421	C97G	probably benign	Het
Ano8	T	C	8: 71,478,958		probably benign	Het
Arsk	T	A	13: 76,062,410	H506L	probably benign	Het
Asgr2	G	T	11: 70,096,832	R52L	probably damaging	Het
Atp2a1	A	G	7: 126,459,608	I145T	possibly damaging	Het
Atrnl1	A	G	19: 57,714,702	T1051A	probably damaging	Het
Cacna1e	A	T	1: 154,486,569	V424D	possibly damaging	Het
Capn3	T	C	2: 120,497,013	V574A	probably benign	Het
Capzb	C	A	4: 139,257,368	D67E	probably damaging	Het
Ccdc68	A	T	18: 69,955,991	T202S	probably benign	Het
Ccser2	T	C	14: 36,896,313	K123R	probably damaging	Het
Ccser2	T	A	14: 36,896,314	K123*	probably null	Het
Ces2h	T	C	8: 105,017,841	I316T	probably benign	Het
Chd3	T	G	11: 69,364,697	K122Q	possibly damaging	Het
Col12a1	T	C	9: 79,672,997	T1533A	probably benign	Het
Cr2	T	A	1: 195,155,905	K1084*	probably null	Het
Ddx28	A	G	8: 106,010,682	L248P	probably benign	Het
Depdc5	A	G	5: 32,917,942	E488G	probably benign	Het
Dld	T	C	12: 31,334,746	T305A	probably benign	Het
Dok5	T	A	2: 170,841,453	F211L	probably damaging	Het
Duox2	T	C	2: 122,287,051	D934G	probably benign	Het
Eif3a	G	A	19: 60,766,798	T982I	unknown	Het
Erbb2	G	T	11: 98,435,335	R979L	probably benign	Het
Espl1	G	T	15: 102,298,529	V143L	possibly damaging	Het
Fanci	T	C	7: 79,430,488	L598P	probably damaging	Het
Fat2	T	A	11: 55,256,647	E3923V	probably damaging	Het
Fhod3	A	T	18: 24,770,493	K95*	probably null	Het
Gm16286	T	C	18: 80,211,946	S152P	probably benign	Het
Gm7534	C	G	4: 134,200,299	C381S	probably damaging	Het
Gm7534	T	A	4: 134,202,119	T292S	possibly damaging	Het
Gpr108	G	T	17: 57,236,217	T484K	probably damaging	Het
Hao1	T	A	2: 134,498,318	N351I	possibly damaging	Het
Hepacam	A	T	9: 37,383,893	N308I	possibly damaging	Het
Herc2	T	C	7: 56,148,823		probably null	Het
Hltf	T	C	3: 20,076,521	I301T	probably benign	Het
Igsf10	A	T	3: 59,319,093	N2386K	probably damaging	Het
Ikbke	G	T	1: 131,259,200	T585K	probably benign	Het
Iqgap3	A	G	3: 88,113,980	T448A	possibly damaging	Het
Kl	T	C	5: 150,980,985	S401P	possibly damaging	Het
Lama4	T	C	10: 39,065,619	V684A	probably benign	Het
Lgals8	A	T	13: 12,454,943	F45Y	probably damaging	Het
Lgalsl	G	A	11: 20,826,491	R134C	probably benign	Het
Lmcd1	T	C	6: 112,329,914	V349A	probably benign	Het
Lrp1b	T	A	2: 41,728,706	N119Y	possibly damaging	Het
Lrrc73	T	A	17: 46,255,695	I157N	probably damaging	Het
Map3k8	A	G	18: 4,334,766	Y293H	probably damaging	Het
Mybphl	A	T	3: 108,375,084		probably null	Het
Ndrg1	A	G	15: 66,931,081	M140T	possibly damaging	Het
Olfr138	T	A	17: 38,275,106	C112S	possibly damaging	Het
Olfr885	A	G	9: 38,061,500	Y60C	probably damaging	Het
Pbx2	T	C	17: 34,593,977	S76P	possibly damaging	Het
Plcl2	T	A	17: 50,606,798	S278R	probably benign	Het
Polr3d	A	T	14: 70,439,475	L393*	probably null	Het
Prmt6	T	C	3: 110,250,367	Q202R	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sag	T	A	1: 87,831,940	I300N	probably damaging	Het
Sap25	T	A	5: 137,641,918		probably null	Het
Scarb2	A	G	5: 92,460,836	L177P	probably damaging	Het
Sh3pxd2b	A	T	11: 32,422,203	N457Y	possibly damaging	Het
Siae	T	A	9: 37,631,606		probably null	Het
Slc36a1	T	C	11: 55,228,324	L375P	probably damaging	Het
Smg8	A	G	11: 87,085,768	V329A	probably damaging	Het
Tas2r113	A	T	6: 132,893,732	Y241F	probably damaging	Het
Tm9sf3	T	G	19: 41,256,229	S70R	probably benign	Het
Tmem144	C	T	3: 79,825,287	S228N	probably damaging	Het
Tmem45a	C	A	16: 56,822,338	V157F	possibly damaging	Het
Tpbg	G	T	9: 85,844,376	V133L	probably damaging	Het
Trpv3	G	A	11: 73,295,383	V667I	possibly damaging	Het
Ube2c	T	C	2: 164,771,321	F53S	probably damaging	Het
Vmn1r78	T	A	7: 12,153,323	V287D	probably damaging	Het
Vmn2r114	T	A	17: 23,308,061	D499V	probably benign	Het

Other mutations in Anpep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Anpep	APN	7	79825736	missense	possibly damaging	0.64
IGL00089:Anpep	APN	7	79841986	missense	probably damaging	1.00
IGL00767:Anpep	APN	7	79840890	missense	probably benign	0.00
IGL00901:Anpep	APN	7	79839423	missense	probably benign
IGL01919:Anpep	APN	7	79825350	missense	possibly damaging	0.77
IGL02049:Anpep	APN	7	79835181	missense	probably damaging	0.97
IGL02195:Anpep	APN	7	79826685	missense	probably damaging	1.00
IGL02210:Anpep	APN	7	79826904	missense	probably benign	0.00
IGL02584:Anpep	APN	7	79825393	splice site	probably benign
IGL02677:Anpep	APN	7	79838730	missense	probably damaging	1.00
IGL03073:Anpep	APN	7	79838955	missense	probably damaging	1.00
IGL03100:Anpep	APN	7	79836361	missense	probably benign	0.01
PIT4696001:Anpep	UTSW	7	79839464	missense	possibly damaging	0.85
R0329:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0330:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0619:Anpep	UTSW	7	79841009	missense	probably benign
R0691:Anpep	UTSW	7	79839299	missense	probably damaging	0.98
R1004:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1005:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1274:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1288:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1289:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1532:Anpep	UTSW	7	79826948	nonsense	probably null
R1540:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1618:Anpep	UTSW	7	79835417	missense	probably benign	0.00
R1627:Anpep	UTSW	7	79842011	missense	probably benign
R1693:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1717:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1745:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1746:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1809:Anpep	UTSW	7	79841823	missense	probably benign	0.01
R1901:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1902:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1903:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1985:Anpep	UTSW	7	79840857	splice site	probably null
R2379:Anpep	UTSW	7	79841218	missense	probably benign	0.28
R2508:Anpep	UTSW	7	79838291	missense	possibly damaging	0.80
R3110:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3112:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3898:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3899:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3900:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R4211:Anpep	UTSW	7	79840996	nonsense	probably null
R4701:Anpep	UTSW	7	79839465	missense	probably benign	0.16
R4716:Anpep	UTSW	7	79826632	missense	probably benign	0.00
R5020:Anpep	UTSW	7	79833727	missense	probably benign
R5042:Anpep	UTSW	7	79839469	missense	probably benign	0.00
R5084:Anpep	UTSW	7	79826870	critical splice donor site	probably null
R5319:Anpep	UTSW	7	79841731	missense	probably benign
R5593:Anpep	UTSW	7	79842046	missense	probably benign	0.04
R5778:Anpep	UTSW	7	79836391	missense	probably benign	0.00
R5852:Anpep	UTSW	7	79838972	nonsense	probably null
R5906:Anpep	UTSW	7	79833675	missense	probably benign
R6164:Anpep	UTSW	7	79842205	missense	possibly damaging	0.68
R6254:Anpep	UTSW	7	79839233	missense	probably damaging	1.00
R6284:Anpep	UTSW	7	79825802	missense	probably damaging	1.00
R6380:Anpep	UTSW	7	79841896	missense	probably benign	0.04
R6594:Anpep	UTSW	7	79841361	splice site	probably null
R6746:Anpep	UTSW	7	79839185	splice site	probably null
R6920:Anpep	UTSW	7	79825349	missense	probably damaging	1.00
R7060:Anpep	UTSW	7	79841794	missense	probably benign	0.33
R7072:Anpep	UTSW	7	79835379	missense	possibly damaging	0.58
R7095:Anpep	UTSW	7	79842202	missense	possibly damaging	0.87
R7102:Anpep	UTSW	7	79836313	missense	probably benign	0.00
R7178:Anpep	UTSW	7	79840988	missense	probably benign
R7223:Anpep	UTSW	7	79825310	missense	probably damaging	1.00
R7344:Anpep	UTSW	7	79838650	missense	possibly damaging	0.60
R7441:Anpep	UTSW	7	79827644	missense	possibly damaging	0.93
R7479:Anpep	UTSW	7	79835370	missense	probably benign	0.11
R7503:Anpep	UTSW	7	79826637	missense	probably damaging	1.00
R7683:Anpep	UTSW	7	79839198	missense	probably damaging	0.98
R7912:Anpep	UTSW	7	79838426	missense	probably benign	0.00
R7935:Anpep	UTSW	7	79826961	missense	possibly damaging	0.46
R8036:Anpep	UTSW	7	79841898	missense	probably benign	0.11
R8039:Anpep	UTSW	7	79839400	critical splice donor site	probably null
R8470:Anpep	UTSW	7	79839521	missense	probably benign	0.16
R8549:Anpep	UTSW	7	79840896	missense	probably benign	0.00
R8723:Anpep	UTSW	7	79838938	missense	probably damaging	1.00
R8726:Anpep	UTSW	7	79840893	missense	probably benign	0.00
R9042:Anpep	UTSW	7	79838762	missense	probably damaging	0.99
R9151:Anpep	UTSW	7	79842037	missense	probably benign	0.31
R9200:Anpep	UTSW	7	79841122	missense	probably benign	0.00
R9216:Anpep	UTSW	7	79836301	missense	possibly damaging	0.49
R9570:Anpep	UTSW	7	79826913	missense	probably benign	0.00
R9769:Anpep	UTSW	7	79838730	missense	probably damaging	1.00
Z1176:Anpep	UTSW	7	79827639	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- GGCTATGAGCAGAGGTTTTACCCAC -3'
(R):5'- TGCCACTCTGGGAATGCTTGAC -3'

Sequencing Primer
(F):5'- ATTACTGAGCACAGCAGCTG -3'
(R):5'- TCCAGTTTCCTGACAGAGGAC -3'

Posted On

2014-05-23