Incidental Mutation 'R1748:Atp2a1'
ID194120
Institutional Source Beutler Lab
Gene Symbol Atp2a1
Ensembl Gene ENSMUSG00000030730
Gene NameATPase, Ca++ transporting, cardiac muscle, fast twitch 1
SynonymsSERCA1
MMRRC Submission 039780-MU
Accession Numbers

Genbank: NM_007504.2; Ensembl: ENSMUST00000032974

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1748 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126445858-126463108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126459608 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 145 (I145T)
Ref Sequence ENSEMBL: ENSMUSP00000032974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032974]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032974
AA Change: I145T

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730
AA Change: I145T

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.39e-16 SMART
Pfam:E1-E2_ATPase 92 340 1.5e-66 PFAM
Pfam:Hydrolase 345 715 7.5e-20 PFAM
Pfam:HAD 348 712 1.2e-18 PFAM
Pfam:Cation_ATPase 418 528 3.2e-23 PFAM
Pfam:Hydrolase_3 683 747 2.3e-7 PFAM
Pfam:Cation_ATPase_C 784 987 4.8e-46 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant neonates display respiratory distress, progressive cyanosis, and die within 30 minutes-2 hours after birth. Lung tissues and the diaphragm muscle show aberrant morphology. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,333,588 Q1403K probably benign Het
Adamts12 G A 15: 11,241,462 M373I probably damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aire T C 10: 78,043,480 H15R probably damaging Het
Aldh3b2 T C 19: 3,977,572 F38L probably damaging Het
Alk A C 17: 72,603,421 C97G probably benign Het
Ano8 T C 8: 71,478,958 probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arsk T A 13: 76,062,410 H506L probably benign Het
Asgr2 G T 11: 70,096,832 R52L probably damaging Het
Atrnl1 A G 19: 57,714,702 T1051A probably damaging Het
Cacna1e A T 1: 154,486,569 V424D possibly damaging Het
Capn3 T C 2: 120,497,013 V574A probably benign Het
Capzb C A 4: 139,257,368 D67E probably damaging Het
Ccdc68 A T 18: 69,955,991 T202S probably benign Het
Ccser2 T C 14: 36,896,313 K123R probably damaging Het
Ccser2 T A 14: 36,896,314 K123* probably null Het
Ces2h T C 8: 105,017,841 I316T probably benign Het
Chd3 T G 11: 69,364,697 K122Q possibly damaging Het
Col12a1 T C 9: 79,672,997 T1533A probably benign Het
Cr2 T A 1: 195,155,905 K1084* probably null Het
Ddx28 A G 8: 106,010,682 L248P probably benign Het
Depdc5 A G 5: 32,917,942 E488G probably benign Het
Dld T C 12: 31,334,746 T305A probably benign Het
Dok5 T A 2: 170,841,453 F211L probably damaging Het
Duox2 T C 2: 122,287,051 D934G probably benign Het
Eif3a G A 19: 60,766,798 T982I unknown Het
Erbb2 G T 11: 98,435,335 R979L probably benign Het
Espl1 G T 15: 102,298,529 V143L possibly damaging Het
Fanci T C 7: 79,430,488 L598P probably damaging Het
Fat2 T A 11: 55,256,647 E3923V probably damaging Het
Fhod3 A T 18: 24,770,493 K95* probably null Het
Gm16286 T C 18: 80,211,946 S152P probably benign Het
Gm7534 C G 4: 134,200,299 C381S probably damaging Het
Gm7534 T A 4: 134,202,119 T292S possibly damaging Het
Gpr108 G T 17: 57,236,217 T484K probably damaging Het
Hao1 T A 2: 134,498,318 N351I possibly damaging Het
Hepacam A T 9: 37,383,893 N308I possibly damaging Het
Herc2 T C 7: 56,148,823 probably null Het
Hltf T C 3: 20,076,521 I301T probably benign Het
Igsf10 A T 3: 59,319,093 N2386K probably damaging Het
Ikbke G T 1: 131,259,200 T585K probably benign Het
Iqgap3 A G 3: 88,113,980 T448A possibly damaging Het
Kl T C 5: 150,980,985 S401P possibly damaging Het
Lama4 T C 10: 39,065,619 V684A probably benign Het
Lgals8 A T 13: 12,454,943 F45Y probably damaging Het
Lgalsl G A 11: 20,826,491 R134C probably benign Het
Lmcd1 T C 6: 112,329,914 V349A probably benign Het
Lrp1b T A 2: 41,728,706 N119Y possibly damaging Het
Lrrc73 T A 17: 46,255,695 I157N probably damaging Het
Map3k8 A G 18: 4,334,766 Y293H probably damaging Het
Mybphl A T 3: 108,375,084 probably null Het
Ndrg1 A G 15: 66,931,081 M140T possibly damaging Het
Olfr138 T A 17: 38,275,106 C112S possibly damaging Het
Olfr885 A G 9: 38,061,500 Y60C probably damaging Het
Pbx2 T C 17: 34,593,977 S76P possibly damaging Het
Plcl2 T A 17: 50,606,798 S278R probably benign Het
Polr3d A T 14: 70,439,475 L393* probably null Het
Prmt6 T C 3: 110,250,367 Q202R probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sag T A 1: 87,831,940 I300N probably damaging Het
Sap25 T A 5: 137,641,918 probably null Het
Scarb2 A G 5: 92,460,836 L177P probably damaging Het
Sh3pxd2b A T 11: 32,422,203 N457Y possibly damaging Het
Siae T A 9: 37,631,606 probably null Het
Slc36a1 T C 11: 55,228,324 L375P probably damaging Het
Smg8 A G 11: 87,085,768 V329A probably damaging Het
Tas2r113 A T 6: 132,893,732 Y241F probably damaging Het
Tm9sf3 T G 19: 41,256,229 S70R probably benign Het
Tmem144 C T 3: 79,825,287 S228N probably damaging Het
Tmem45a C A 16: 56,822,338 V157F possibly damaging Het
Tpbg G T 9: 85,844,376 V133L probably damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ube2c T C 2: 164,771,321 F53S probably damaging Het
Vmn1r78 T A 7: 12,153,323 V287D probably damaging Het
Vmn2r114 T A 17: 23,308,061 D499V probably benign Het
Other mutations in Atp2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Atp2a1 APN 7 126447216 nonsense probably null
IGL00474:Atp2a1 APN 7 126450294 nonsense probably null
IGL00500:Atp2a1 APN 7 126447216 nonsense probably null
IGL01112:Atp2a1 APN 7 126450307 missense probably benign 0.13
IGL01380:Atp2a1 APN 7 126448770 missense possibly damaging 0.84
IGL01503:Atp2a1 APN 7 126448578 missense probably damaging 1.00
IGL01630:Atp2a1 APN 7 126450265 missense probably benign 0.00
IGL01679:Atp2a1 APN 7 126456809 missense probably benign 0.00
IGL01729:Atp2a1 APN 7 126457934 missense probably damaging 0.99
IGL02290:Atp2a1 APN 7 126452649 splice site probably benign
IGL02929:Atp2a1 APN 7 126456944 missense probably damaging 1.00
IGL02951:Atp2a1 APN 7 126450227 missense possibly damaging 0.58
IGL03249:Atp2a1 APN 7 126462805 missense probably benign 0.12
1mM(1):Atp2a1 UTSW 7 126446909 missense probably damaging 1.00
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0070:Atp2a1 UTSW 7 126447452 missense probably benign 0.03
R0070:Atp2a1 UTSW 7 126447452 missense probably benign 0.03
R0121:Atp2a1 UTSW 7 126457944 missense probably damaging 1.00
R0398:Atp2a1 UTSW 7 126450418 unclassified probably benign
R0578:Atp2a1 UTSW 7 126450143 missense probably benign
R0626:Atp2a1 UTSW 7 126446990 critical splice acceptor site probably null
R0739:Atp2a1 UTSW 7 126448256 missense possibly damaging 0.87
R1558:Atp2a1 UTSW 7 126452672 missense possibly damaging 0.88
R1700:Atp2a1 UTSW 7 126462909 missense probably damaging 1.00
R1799:Atp2a1 UTSW 7 126450142 missense probably benign 0.27
R1808:Atp2a1 UTSW 7 126453401 missense probably damaging 0.97
R2058:Atp2a1 UTSW 7 126447672 missense possibly damaging 0.60
R2143:Atp2a1 UTSW 7 126448725 nonsense probably null
R2427:Atp2a1 UTSW 7 126446583 makesense probably null
R3113:Atp2a1 UTSW 7 126448369 missense probably damaging 1.00
R4501:Atp2a1 UTSW 7 126453383 missense probably benign 0.00
R4604:Atp2a1 UTSW 7 126448623 missense probably damaging 0.96
R4934:Atp2a1 UTSW 7 126453428 missense probably benign
R4939:Atp2a1 UTSW 7 126450116 missense probably benign
R5646:Atp2a1 UTSW 7 126453105 missense probably benign
R6093:Atp2a1 UTSW 7 126446921 missense probably damaging 1.00
R6556:Atp2a1 UTSW 7 126450262 missense probably benign 0.37
R6908:Atp2a1 UTSW 7 126448535 critical splice donor site probably null
R6911:Atp2a1 UTSW 7 126456836 missense probably damaging 1.00
R7206:Atp2a1 UTSW 7 126447972 missense probably benign 0.01
R7354:Atp2a1 UTSW 7 126448856 missense probably damaging 1.00
R7363:Atp2a1 UTSW 7 126462889 missense possibly damaging 0.88
R7501:Atp2a1 UTSW 7 126450172 missense probably benign 0.29
R7560:Atp2a1 UTSW 7 126459656 missense possibly damaging 0.95
R7716:Atp2a1 UTSW 7 126462187 missense possibly damaging 0.86
R7772:Atp2a1 UTSW 7 126448535 critical splice donor site probably null
R8039:Atp2a1 UTSW 7 126448805 missense probably damaging 0.99
R8391:Atp2a1 UTSW 7 126448716 missense possibly damaging 0.94
R8478:Atp2a1 UTSW 7 126448330 missense probably damaging 1.00
X0022:Atp2a1 UTSW 7 126448250 missense possibly damaging 0.49
X0060:Atp2a1 UTSW 7 126462882 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GTCAAGACTGAAAGCTGACCACTGG -3'
(R):5'- ACAAACGCAGCCCTGCTGTATG -3'

Sequencing Primer
(F):5'- CAGGACTAGCTGTTCCTATTGAGAC -3'
(R):5'- TGGACCTGCATAAGCCAGTC -3'
Posted On2014-05-23