Incidental Mutation 'R1748:Ddx28'
ID194125
Institutional Source Beutler Lab
Gene Symbol Ddx28
Ensembl Gene ENSMUSG00000045538
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Synonyms2410004K13Rik, Mddx28
MMRRC Submission 039780-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R1748 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106009621-106011882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106010682 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 248 (L248P)
Ref Sequence ENSEMBL: ENSMUSP00000058950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034375] [ENSMUST00000058579] [ENSMUST00000119736] [ENSMUST00000142898] [ENSMUST00000227778]
Predicted Effect probably benign
Transcript: ENSMUST00000034375
SMART Domains Protein: ENSMUSP00000034375
Gene: ENSMUSG00000031901

DomainStartEndE-ValueType
Pfam:Dus 15 344 1.8e-54 PFAM
DSRM 370 435 1.03e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000058579
AA Change: L248P

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000058950
Gene: ENSMUSG00000045538
AA Change: L248P

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
low complexity region 42 58 N/A INTRINSIC
DEXDc 147 365 1.64e-40 SMART
HELICc 411 492 6.89e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119736
SMART Domains Protein: ENSMUSP00000113781
Gene: ENSMUSG00000031901

DomainStartEndE-ValueType
Pfam:Dus 1 233 8.1e-38 PFAM
DSRM 257 322 1.03e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141374
Predicted Effect probably benign
Transcript: ENSMUST00000142898
Predicted Effect probably benign
Transcript: ENSMUST00000227778
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is intronless. It encodes an RNA-dependent ATPase. The encoded protein is localized in the mitochondria and the nucleus, and can be transported between the mitochondria and the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,333,588 Q1403K probably benign Het
Adamts12 G A 15: 11,241,462 M373I probably damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aire T C 10: 78,043,480 H15R probably damaging Het
Aldh3b2 T C 19: 3,977,572 F38L probably damaging Het
Alk A C 17: 72,603,421 C97G probably benign Het
Ano8 T C 8: 71,478,958 probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arsk T A 13: 76,062,410 H506L probably benign Het
Asgr2 G T 11: 70,096,832 R52L probably damaging Het
Atp2a1 A G 7: 126,459,608 I145T possibly damaging Het
Atrnl1 A G 19: 57,714,702 T1051A probably damaging Het
Cacna1e A T 1: 154,486,569 V424D possibly damaging Het
Capn3 T C 2: 120,497,013 V574A probably benign Het
Capzb C A 4: 139,257,368 D67E probably damaging Het
Ccdc68 A T 18: 69,955,991 T202S probably benign Het
Ccser2 T C 14: 36,896,313 K123R probably damaging Het
Ccser2 T A 14: 36,896,314 K123* probably null Het
Ces2h T C 8: 105,017,841 I316T probably benign Het
Chd3 T G 11: 69,364,697 K122Q possibly damaging Het
Col12a1 T C 9: 79,672,997 T1533A probably benign Het
Cr2 T A 1: 195,155,905 K1084* probably null Het
Depdc5 A G 5: 32,917,942 E488G probably benign Het
Dld T C 12: 31,334,746 T305A probably benign Het
Dok5 T A 2: 170,841,453 F211L probably damaging Het
Duox2 T C 2: 122,287,051 D934G probably benign Het
Eif3a G A 19: 60,766,798 T982I unknown Het
Erbb2 G T 11: 98,435,335 R979L probably benign Het
Espl1 G T 15: 102,298,529 V143L possibly damaging Het
Fanci T C 7: 79,430,488 L598P probably damaging Het
Fat2 T A 11: 55,256,647 E3923V probably damaging Het
Fhod3 A T 18: 24,770,493 K95* probably null Het
Gm16286 T C 18: 80,211,946 S152P probably benign Het
Gm7534 C G 4: 134,200,299 C381S probably damaging Het
Gm7534 T A 4: 134,202,119 T292S possibly damaging Het
Gpr108 G T 17: 57,236,217 T484K probably damaging Het
Hao1 T A 2: 134,498,318 N351I possibly damaging Het
Hepacam A T 9: 37,383,893 N308I possibly damaging Het
Herc2 T C 7: 56,148,823 probably null Het
Hltf T C 3: 20,076,521 I301T probably benign Het
Igsf10 A T 3: 59,319,093 N2386K probably damaging Het
Ikbke G T 1: 131,259,200 T585K probably benign Het
Iqgap3 A G 3: 88,113,980 T448A possibly damaging Het
Kl T C 5: 150,980,985 S401P possibly damaging Het
Lama4 T C 10: 39,065,619 V684A probably benign Het
Lgals8 A T 13: 12,454,943 F45Y probably damaging Het
Lgalsl G A 11: 20,826,491 R134C probably benign Het
Lmcd1 T C 6: 112,329,914 V349A probably benign Het
Lrp1b T A 2: 41,728,706 N119Y possibly damaging Het
Lrrc73 T A 17: 46,255,695 I157N probably damaging Het
Map3k8 A G 18: 4,334,766 Y293H probably damaging Het
Mybphl A T 3: 108,375,084 probably null Het
Ndrg1 A G 15: 66,931,081 M140T possibly damaging Het
Olfr138 T A 17: 38,275,106 C112S possibly damaging Het
Olfr885 A G 9: 38,061,500 Y60C probably damaging Het
Pbx2 T C 17: 34,593,977 S76P possibly damaging Het
Plcl2 T A 17: 50,606,798 S278R probably benign Het
Polr3d A T 14: 70,439,475 L393* probably null Het
Prmt6 T C 3: 110,250,367 Q202R probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sag T A 1: 87,831,940 I300N probably damaging Het
Sap25 T A 5: 137,641,918 probably null Het
Scarb2 A G 5: 92,460,836 L177P probably damaging Het
Sh3pxd2b A T 11: 32,422,203 N457Y possibly damaging Het
Siae T A 9: 37,631,606 probably null Het
Slc36a1 T C 11: 55,228,324 L375P probably damaging Het
Smg8 A G 11: 87,085,768 V329A probably damaging Het
Tas2r113 A T 6: 132,893,732 Y241F probably damaging Het
Tm9sf3 T G 19: 41,256,229 S70R probably benign Het
Tmem144 C T 3: 79,825,287 S228N probably damaging Het
Tmem45a C A 16: 56,822,338 V157F possibly damaging Het
Tpbg G T 9: 85,844,376 V133L probably damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ube2c T C 2: 164,771,321 F53S probably damaging Het
Vmn1r78 T A 7: 12,153,323 V287D probably damaging Het
Vmn2r114 T A 17: 23,308,061 D499V probably benign Het
Other mutations in Ddx28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Ddx28 APN 8 106010580 missense probably damaging 0.97
R0166:Ddx28 UTSW 8 106010289 missense probably benign 0.00
R0329:Ddx28 UTSW 8 106010245 missense probably benign 0.00
R0362:Ddx28 UTSW 8 106011294 missense probably damaging 0.99
R0464:Ddx28 UTSW 8 106010053 missense probably damaging 1.00
R1267:Ddx28 UTSW 8 106009917 missense probably damaging 1.00
R1686:Ddx28 UTSW 8 106010558 missense probably damaging 1.00
R2201:Ddx28 UTSW 8 106010574 missense probably damaging 1.00
R4005:Ddx28 UTSW 8 106010928 missense possibly damaging 0.80
R6456:Ddx28 UTSW 8 106010368 missense possibly damaging 0.94
R6601:Ddx28 UTSW 8 106010616 splice site probably null
R7295:Ddx28 UTSW 8 106010844 missense probably benign
R7320:Ddx28 UTSW 8 106011325 missense probably damaging 0.96
R7690:Ddx28 UTSW 8 106010331 missense probably damaging 1.00
R8427:Ddx28 UTSW 8 106010280 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGTAGTCCACCAGTTCCAGGAAGC -3'
(R):5'- TCTCCATAGAGCGAGTGCAGCAAG -3'

Sequencing Primer
(F):5'- AAGCTTTCATCTAGCAGTGTGTC -3'
(R):5'- TGGCAAGACGCTTAGCTAC -3'
Posted On2014-05-23