Mutagenetix > Incidental Mutation

Incidental Mutation 'R1748:Sh3pxd2b'

194135

Institutional Source

Beutler Lab

Gene Symbol

Sh3pxd2b

Ensembl Gene

ENSMUSG00000040711

Gene Name

SH3 and PX domains 2B

Synonyms

G431001E03Rik, Fad49, Tsk4

MMRRC Submission

039780-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.408) question?

Stock #

R1748 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32347820-32428173 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 32422203 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Tyrosine at position 457 (N457Y)

Ref Sequence

ENSEMBL: ENSMUSP00000044276 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038753]

AlphaFold

A2AAY5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038753
AA Change: N457Y

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000044276
Gene: ENSMUSG00000040711
AA Change: N457Y

Domain	Start	End	E-Value	Type
PX	5	125	2.65e-30	SMART
SH3	155	210	1.11e-14	SMART
SH3	224	279	3.78e-17	SMART
SH3	371	426	2.33e-8	SMART
low complexity region	525	540	N/A	INTRINSIC
low complexity region	748	772	N/A	INTRINSIC
SH3	850	908	5.75e-8	SMART

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome (FTHS), and also Borrone Dermato-Cardio-Skeletal (BDCS) syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal craniofacial morphology, decreased bone density, impaired hearing secondary to otis media, reduced growth, size, and weight, and decreased white adipose tissue. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	T	16: 20,333,588	Q1403K	probably benign	Het
Adamts12	G	A	15: 11,241,462	M373I	probably damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Aire	T	C	10: 78,043,480	H15R	probably damaging	Het
Aldh3b2	T	C	19: 3,977,572	F38L	probably damaging	Het
Alk	A	C	17: 72,603,421	C97G	probably benign	Het
Ano8	T	C	8: 71,478,958		probably benign	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arsk	T	A	13: 76,062,410	H506L	probably benign	Het
Asgr2	G	T	11: 70,096,832	R52L	probably damaging	Het
Atp2a1	A	G	7: 126,459,608	I145T	possibly damaging	Het
Atrnl1	A	G	19: 57,714,702	T1051A	probably damaging	Het
Cacna1e	A	T	1: 154,486,569	V424D	possibly damaging	Het
Capn3	T	C	2: 120,497,013	V574A	probably benign	Het
Capzb	C	A	4: 139,257,368	D67E	probably damaging	Het
Ccdc68	A	T	18: 69,955,991	T202S	probably benign	Het
Ccser2	T	C	14: 36,896,313	K123R	probably damaging	Het
Ccser2	T	A	14: 36,896,314	K123*	probably null	Het
Ces2h	T	C	8: 105,017,841	I316T	probably benign	Het
Chd3	T	G	11: 69,364,697	K122Q	possibly damaging	Het
Col12a1	T	C	9: 79,672,997	T1533A	probably benign	Het
Cr2	T	A	1: 195,155,905	K1084*	probably null	Het
Ddx28	A	G	8: 106,010,682	L248P	probably benign	Het
Depdc5	A	G	5: 32,917,942	E488G	probably benign	Het
Dld	T	C	12: 31,334,746	T305A	probably benign	Het
Dok5	T	A	2: 170,841,453	F211L	probably damaging	Het
Duox2	T	C	2: 122,287,051	D934G	probably benign	Het
Eif3a	G	A	19: 60,766,798	T982I	unknown	Het
Erbb2	G	T	11: 98,435,335	R979L	probably benign	Het
Espl1	G	T	15: 102,298,529	V143L	possibly damaging	Het
Fanci	T	C	7: 79,430,488	L598P	probably damaging	Het
Fat2	T	A	11: 55,256,647	E3923V	probably damaging	Het
Fhod3	A	T	18: 24,770,493	K95*	probably null	Het
Gm16286	T	C	18: 80,211,946	S152P	probably benign	Het
Gm7534	C	G	4: 134,200,299	C381S	probably damaging	Het
Gm7534	T	A	4: 134,202,119	T292S	possibly damaging	Het
Gpr108	G	T	17: 57,236,217	T484K	probably damaging	Het
Hao1	T	A	2: 134,498,318	N351I	possibly damaging	Het
Hepacam	A	T	9: 37,383,893	N308I	possibly damaging	Het
Herc2	T	C	7: 56,148,823		probably null	Het
Hltf	T	C	3: 20,076,521	I301T	probably benign	Het
Igsf10	A	T	3: 59,319,093	N2386K	probably damaging	Het
Ikbke	G	T	1: 131,259,200	T585K	probably benign	Het
Iqgap3	A	G	3: 88,113,980	T448A	possibly damaging	Het
Kl	T	C	5: 150,980,985	S401P	possibly damaging	Het
Lama4	T	C	10: 39,065,619	V684A	probably benign	Het
Lgals8	A	T	13: 12,454,943	F45Y	probably damaging	Het
Lgalsl	G	A	11: 20,826,491	R134C	probably benign	Het
Lmcd1	T	C	6: 112,329,914	V349A	probably benign	Het
Lrp1b	T	A	2: 41,728,706	N119Y	possibly damaging	Het
Lrrc73	T	A	17: 46,255,695	I157N	probably damaging	Het
Map3k8	A	G	18: 4,334,766	Y293H	probably damaging	Het
Mybphl	A	T	3: 108,375,084		probably null	Het
Ndrg1	A	G	15: 66,931,081	M140T	possibly damaging	Het
Olfr138	T	A	17: 38,275,106	C112S	possibly damaging	Het
Olfr885	A	G	9: 38,061,500	Y60C	probably damaging	Het
Pbx2	T	C	17: 34,593,977	S76P	possibly damaging	Het
Plcl2	T	A	17: 50,606,798	S278R	probably benign	Het
Polr3d	A	T	14: 70,439,475	L393*	probably null	Het
Prmt6	T	C	3: 110,250,367	Q202R	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sag	T	A	1: 87,831,940	I300N	probably damaging	Het
Sap25	T	A	5: 137,641,918		probably null	Het
Scarb2	A	G	5: 92,460,836	L177P	probably damaging	Het
Siae	T	A	9: 37,631,606		probably null	Het
Slc36a1	T	C	11: 55,228,324	L375P	probably damaging	Het
Smg8	A	G	11: 87,085,768	V329A	probably damaging	Het
Tas2r113	A	T	6: 132,893,732	Y241F	probably damaging	Het
Tm9sf3	T	G	19: 41,256,229	S70R	probably benign	Het
Tmem144	C	T	3: 79,825,287	S228N	probably damaging	Het
Tmem45a	C	A	16: 56,822,338	V157F	possibly damaging	Het
Tpbg	G	T	9: 85,844,376	V133L	probably damaging	Het
Trpv3	G	A	11: 73,295,383	V667I	possibly damaging	Het
Ube2c	T	C	2: 164,771,321	F53S	probably damaging	Het
Vmn1r78	T	A	7: 12,153,323	V287D	probably damaging	Het
Vmn2r114	T	A	17: 23,308,061	D499V	probably benign	Het

Other mutations in Sh3pxd2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01017:Sh3pxd2b	APN	11	32403993	nonsense	probably null
IGL01581:Sh3pxd2b	APN	11	32387973	missense	possibly damaging	0.64
IGL02067:Sh3pxd2b	APN	11	32423095	missense	probably benign	0.01
IGL02412:Sh3pxd2b	APN	11	32387992	missense	probably damaging	0.99
IGL02930:Sh3pxd2b	APN	11	32417161	missense	possibly damaging	0.91
IGL03299:Sh3pxd2b	APN	11	32411448	splice site	probably benign
IGL03378:Sh3pxd2b	APN	11	32381443	missense	probably damaging	1.00
FR4449:Sh3pxd2b	UTSW	11	32423065	small insertion	probably benign
FR4548:Sh3pxd2b	UTSW	11	32423064	small insertion	probably benign
FR4548:Sh3pxd2b	UTSW	11	32423065	small insertion	probably benign
FR4976:Sh3pxd2b	UTSW	11	32423055	small insertion	probably benign
FR4976:Sh3pxd2b	UTSW	11	32423060	small insertion	probably benign
R0097:Sh3pxd2b	UTSW	11	32403978	missense	probably damaging	1.00
R0097:Sh3pxd2b	UTSW	11	32403978	missense	probably damaging	1.00
R0441:Sh3pxd2b	UTSW	11	32423023	missense	possibly damaging	0.77
R0715:Sh3pxd2b	UTSW	11	32423341	missense	possibly damaging	0.93
R1456:Sh3pxd2b	UTSW	11	32415967	missense	probably damaging	1.00
R1616:Sh3pxd2b	UTSW	11	32381441	missense	possibly damaging	0.90
R1902:Sh3pxd2b	UTSW	11	32423559	makesense	probably null
R1977:Sh3pxd2b	UTSW	11	32422138	missense	probably damaging	1.00
R3761:Sh3pxd2b	UTSW	11	32422750	missense	probably benign	0.45
R3850:Sh3pxd2b	UTSW	11	32411505	missense	probably damaging	1.00
R4060:Sh3pxd2b	UTSW	11	32422263	missense	probably benign	0.16
R4062:Sh3pxd2b	UTSW	11	32422263	missense	probably benign	0.16
R4064:Sh3pxd2b	UTSW	11	32422263	missense	probably benign	0.16
R4585:Sh3pxd2b	UTSW	11	32396479	missense	possibly damaging	0.84
R5278:Sh3pxd2b	UTSW	11	32381447	missense	probably damaging	1.00
R5652:Sh3pxd2b	UTSW	11	32422812	missense	probably damaging	1.00
R5827:Sh3pxd2b	UTSW	11	32422422	missense	probably benign	0.01
R5994:Sh3pxd2b	UTSW	11	32407570	missense	probably damaging	1.00
R6083:Sh3pxd2b	UTSW	11	32422985	missense	probably benign	0.30
R6392:Sh3pxd2b	UTSW	11	32423302	missense	possibly damaging	0.74
R6625:Sh3pxd2b	UTSW	11	32422594	missense	possibly damaging	0.74
R6649:Sh3pxd2b	UTSW	11	32415978	splice site	probably null
R7056:Sh3pxd2b	UTSW	11	32422737	missense	probably benign	0.01
R7131:Sh3pxd2b	UTSW	11	32422072	missense	probably damaging	1.00
R7192:Sh3pxd2b	UTSW	11	32414318	missense	probably damaging	1.00
R7911:Sh3pxd2b	UTSW	11	32371533	missense	probably damaging	1.00
R8026:Sh3pxd2b	UTSW	11	32411567	missense	probably damaging	1.00
R8027:Sh3pxd2b	UTSW	11	32422210	missense	probably benign	0.01
R8555:Sh3pxd2b	UTSW	11	32411469	missense	probably benign	0.34
R8939:Sh3pxd2b	UTSW	11	32414433	splice site	probably benign
R9003:Sh3pxd2b	UTSW	11	32411571	missense	probably damaging	0.96
R9090:Sh3pxd2b	UTSW	11	32423361	missense	possibly damaging	0.90
R9271:Sh3pxd2b	UTSW	11	32423361	missense	possibly damaging	0.90
RF016:Sh3pxd2b	UTSW	11	32423053	small insertion	probably benign
RF022:Sh3pxd2b	UTSW	11	32423054	small insertion	probably benign
RF025:Sh3pxd2b	UTSW	11	32423057	small insertion	probably benign
RF040:Sh3pxd2b	UTSW	11	32423055	small insertion	probably benign
RF056:Sh3pxd2b	UTSW	11	32423055	small insertion	probably benign
RF063:Sh3pxd2b	UTSW	11	32423051	small insertion	probably benign
X0017:Sh3pxd2b	UTSW	11	32414359	missense	possibly damaging	0.94
X0028:Sh3pxd2b	UTSW	11	32423110	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCCCTTCTAGGTGATTGAGAAGAGCC -3'
(R):5'- TCCTCGGACAGCTCAGCTTTAGAC -3'

Sequencing Primer
(F):5'- TTGAGAAGAGCCTAAGTGGTTG -3'
(R):5'- ATGTCATTTCTCAGCGGGAAC -3'

Posted On

2014-05-23