Incidental Mutation 'R1748:Sh3pxd2b'
ID 194135
Institutional Source Beutler Lab
Gene Symbol Sh3pxd2b
Ensembl Gene ENSMUSG00000040711
Gene Name SH3 and PX domains 2B
Synonyms Tks4, Fad49, G431001E03Rik
MMRRC Submission 039780-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.348) question?
Stock # R1748 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 32297820-32378173 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 32372203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Tyrosine at position 457 (N457Y)
Ref Sequence ENSEMBL: ENSMUSP00000044276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038753]
AlphaFold A2AAY5
Predicted Effect possibly damaging
Transcript: ENSMUST00000038753
AA Change: N457Y

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000044276
Gene: ENSMUSG00000040711
AA Change: N457Y

DomainStartEndE-ValueType
PX 5 125 2.65e-30 SMART
SH3 155 210 1.11e-14 SMART
SH3 224 279 3.78e-17 SMART
SH3 371 426 2.33e-8 SMART
low complexity region 525 540 N/A INTRINSIC
low complexity region 748 772 N/A INTRINSIC
SH3 850 908 5.75e-8 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adapter protein that is characterized by a PX domain and four Src homology 3 domains. The encoded protein is required for podosome formation and is involved in cell adhesion and migration of numerous cell types. Mutations in this gene are the cause of Frank-ter Haar syndrome (FTHS), and also Borrone Dermato-Cardio-Skeletal (BDCS) syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit abnormal craniofacial morphology, decreased bone density, impaired hearing secondary to otis media, reduced growth, size, and weight, and decreased white adipose tissue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,152,338 (GRCm39) Q1403K probably benign Het
Adamts12 G A 15: 11,241,548 (GRCm39) M373I probably damaging Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Aire T C 10: 77,879,314 (GRCm39) H15R probably damaging Het
Aldh3b2 T C 19: 4,027,572 (GRCm39) F38L probably damaging Het
Alk A C 17: 72,910,416 (GRCm39) C97G probably benign Het
Ano8 T C 8: 71,931,602 (GRCm39) probably benign Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arsk T A 13: 76,210,529 (GRCm39) H506L probably benign Het
Asgr2 G T 11: 69,987,658 (GRCm39) R52L probably damaging Het
Atp2a1 A G 7: 126,058,780 (GRCm39) I145T possibly damaging Het
Atrnl1 A G 19: 57,703,134 (GRCm39) T1051A probably damaging Het
Cacna1e A T 1: 154,362,315 (GRCm39) V424D possibly damaging Het
Capn3 T C 2: 120,327,494 (GRCm39) V574A probably benign Het
Capzb C A 4: 138,984,679 (GRCm39) D67E probably damaging Het
Ccdc68 A T 18: 70,089,062 (GRCm39) T202S probably benign Het
Ccser2 T C 14: 36,618,270 (GRCm39) K123R probably damaging Het
Ccser2 T A 14: 36,618,271 (GRCm39) K123* probably null Het
Ces2h T C 8: 105,744,473 (GRCm39) I316T probably benign Het
Chd3 T G 11: 69,255,523 (GRCm39) K122Q possibly damaging Het
Col12a1 T C 9: 79,580,279 (GRCm39) T1533A probably benign Het
Cr2 T A 1: 194,838,213 (GRCm39) K1084* probably null Het
Ddx28 A G 8: 106,737,314 (GRCm39) L248P probably benign Het
Depdc5 A G 5: 33,075,286 (GRCm39) E488G probably benign Het
Dld T C 12: 31,384,745 (GRCm39) T305A probably benign Het
Dok5 T A 2: 170,683,373 (GRCm39) F211L probably damaging Het
Duox2 T C 2: 122,117,532 (GRCm39) D934G probably benign Het
Eif3a G A 19: 60,755,236 (GRCm39) T982I unknown Het
Erbb2 G T 11: 98,326,161 (GRCm39) R979L probably benign Het
Espl1 G T 15: 102,206,964 (GRCm39) V143L possibly damaging Het
Fanci T C 7: 79,080,236 (GRCm39) L598P probably damaging Het
Fat2 T A 11: 55,147,473 (GRCm39) E3923V probably damaging Het
Fhod3 A T 18: 24,903,550 (GRCm39) K95* probably null Het
Gpr108 G T 17: 57,543,217 (GRCm39) T484K probably damaging Het
Hao1 T A 2: 134,340,238 (GRCm39) N351I possibly damaging Het
Hepacam A T 9: 37,295,189 (GRCm39) N308I possibly damaging Het
Herc2 T C 7: 55,798,571 (GRCm39) probably null Het
Hltf T C 3: 20,130,685 (GRCm39) I301T probably benign Het
Igsf10 A T 3: 59,226,514 (GRCm39) N2386K probably damaging Het
Ikbke G T 1: 131,186,937 (GRCm39) T585K probably benign Het
Iqgap3 A G 3: 88,021,287 (GRCm39) T448A possibly damaging Het
Kl T C 5: 150,904,450 (GRCm39) S401P possibly damaging Het
Lama4 T C 10: 38,941,615 (GRCm39) V684A probably benign Het
Lgals8 A T 13: 12,469,824 (GRCm39) F45Y probably damaging Het
Lgalsl G A 11: 20,776,491 (GRCm39) R134C probably benign Het
Lmcd1 T C 6: 112,306,875 (GRCm39) V349A probably benign Het
Lrp1b T A 2: 41,618,718 (GRCm39) N119Y possibly damaging Het
Lrrc73 T A 17: 46,566,621 (GRCm39) I157N probably damaging Het
Map3k8 A G 18: 4,334,766 (GRCm39) Y293H probably damaging Het
Mybphl A T 3: 108,282,400 (GRCm39) probably null Het
Naa12 T C 18: 80,255,161 (GRCm39) S152P probably benign Het
Ndrg1 A G 15: 66,802,930 (GRCm39) M140T possibly damaging Het
Or2n1e T A 17: 38,585,997 (GRCm39) C112S possibly damaging Het
Or8b38 A G 9: 37,972,796 (GRCm39) Y60C probably damaging Het
Pbx2 T C 17: 34,812,951 (GRCm39) S76P possibly damaging Het
Plcl2 T A 17: 50,913,826 (GRCm39) S278R probably benign Het
Polr3d A T 14: 70,676,915 (GRCm39) L393* probably null Het
Prmt6 T C 3: 110,157,683 (GRCm39) Q202R probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Sag T A 1: 87,759,662 (GRCm39) I300N probably damaging Het
Sap25 T A 5: 137,640,180 (GRCm39) probably null Het
Scarb2 A G 5: 92,608,695 (GRCm39) L177P probably damaging Het
Siae T A 9: 37,542,902 (GRCm39) probably null Het
Slc36a1 T C 11: 55,119,150 (GRCm39) L375P probably damaging Het
Smg8 A G 11: 86,976,594 (GRCm39) V329A probably damaging Het
Tas2r113 A T 6: 132,870,695 (GRCm39) Y241F probably damaging Het
Tm9sf3 T G 19: 41,244,668 (GRCm39) S70R probably benign Het
Tmem144 C T 3: 79,732,594 (GRCm39) S228N probably damaging Het
Tmem45a C A 16: 56,642,701 (GRCm39) V157F possibly damaging Het
Tpbg G T 9: 85,726,429 (GRCm39) V133L probably damaging Het
Trpv3 G A 11: 73,186,209 (GRCm39) V667I possibly damaging Het
Ube2c T C 2: 164,613,241 (GRCm39) F53S probably damaging Het
Vmn1r78 T A 7: 11,887,250 (GRCm39) V287D probably damaging Het
Vmn2r114 T A 17: 23,527,035 (GRCm39) D499V probably benign Het
Zpld2 C G 4: 133,927,610 (GRCm39) C381S probably damaging Het
Zpld2 T A 4: 133,929,430 (GRCm39) T292S possibly damaging Het
Other mutations in Sh3pxd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Sh3pxd2b APN 11 32,353,993 (GRCm39) nonsense probably null
IGL01581:Sh3pxd2b APN 11 32,337,973 (GRCm39) missense possibly damaging 0.64
IGL02067:Sh3pxd2b APN 11 32,373,095 (GRCm39) missense probably benign 0.01
IGL02412:Sh3pxd2b APN 11 32,337,992 (GRCm39) missense probably damaging 0.99
IGL02930:Sh3pxd2b APN 11 32,367,161 (GRCm39) missense possibly damaging 0.91
IGL03299:Sh3pxd2b APN 11 32,361,448 (GRCm39) splice site probably benign
IGL03378:Sh3pxd2b APN 11 32,331,443 (GRCm39) missense probably damaging 1.00
FR4449:Sh3pxd2b UTSW 11 32,373,065 (GRCm39) small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32,373,065 (GRCm39) small insertion probably benign
FR4548:Sh3pxd2b UTSW 11 32,373,064 (GRCm39) small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32,373,060 (GRCm39) small insertion probably benign
FR4976:Sh3pxd2b UTSW 11 32,373,055 (GRCm39) small insertion probably benign
R0097:Sh3pxd2b UTSW 11 32,353,978 (GRCm39) missense probably damaging 1.00
R0097:Sh3pxd2b UTSW 11 32,353,978 (GRCm39) missense probably damaging 1.00
R0441:Sh3pxd2b UTSW 11 32,373,023 (GRCm39) missense possibly damaging 0.77
R0715:Sh3pxd2b UTSW 11 32,373,341 (GRCm39) missense possibly damaging 0.93
R1456:Sh3pxd2b UTSW 11 32,365,967 (GRCm39) missense probably damaging 1.00
R1616:Sh3pxd2b UTSW 11 32,331,441 (GRCm39) missense possibly damaging 0.90
R1902:Sh3pxd2b UTSW 11 32,373,559 (GRCm39) makesense probably null
R1977:Sh3pxd2b UTSW 11 32,372,138 (GRCm39) missense probably damaging 1.00
R3761:Sh3pxd2b UTSW 11 32,372,750 (GRCm39) missense probably benign 0.45
R3850:Sh3pxd2b UTSW 11 32,361,505 (GRCm39) missense probably damaging 1.00
R4060:Sh3pxd2b UTSW 11 32,372,263 (GRCm39) missense probably benign 0.16
R4062:Sh3pxd2b UTSW 11 32,372,263 (GRCm39) missense probably benign 0.16
R4064:Sh3pxd2b UTSW 11 32,372,263 (GRCm39) missense probably benign 0.16
R4585:Sh3pxd2b UTSW 11 32,346,479 (GRCm39) missense possibly damaging 0.84
R5278:Sh3pxd2b UTSW 11 32,331,447 (GRCm39) missense probably damaging 1.00
R5652:Sh3pxd2b UTSW 11 32,372,812 (GRCm39) missense probably damaging 1.00
R5827:Sh3pxd2b UTSW 11 32,372,422 (GRCm39) missense probably benign 0.01
R5994:Sh3pxd2b UTSW 11 32,357,570 (GRCm39) missense probably damaging 1.00
R6083:Sh3pxd2b UTSW 11 32,372,985 (GRCm39) missense probably benign 0.30
R6392:Sh3pxd2b UTSW 11 32,373,302 (GRCm39) missense possibly damaging 0.74
R6625:Sh3pxd2b UTSW 11 32,372,594 (GRCm39) missense possibly damaging 0.74
R6649:Sh3pxd2b UTSW 11 32,365,978 (GRCm39) splice site probably null
R7056:Sh3pxd2b UTSW 11 32,372,737 (GRCm39) missense probably benign 0.01
R7131:Sh3pxd2b UTSW 11 32,372,072 (GRCm39) missense probably damaging 1.00
R7192:Sh3pxd2b UTSW 11 32,364,318 (GRCm39) missense probably damaging 1.00
R7911:Sh3pxd2b UTSW 11 32,321,533 (GRCm39) missense probably damaging 1.00
R8026:Sh3pxd2b UTSW 11 32,361,567 (GRCm39) missense probably damaging 1.00
R8027:Sh3pxd2b UTSW 11 32,372,210 (GRCm39) missense probably benign 0.01
R8555:Sh3pxd2b UTSW 11 32,361,469 (GRCm39) missense probably benign 0.34
R8939:Sh3pxd2b UTSW 11 32,364,433 (GRCm39) splice site probably benign
R9003:Sh3pxd2b UTSW 11 32,361,571 (GRCm39) missense probably damaging 0.96
R9090:Sh3pxd2b UTSW 11 32,373,361 (GRCm39) missense possibly damaging 0.90
R9271:Sh3pxd2b UTSW 11 32,373,361 (GRCm39) missense possibly damaging 0.90
RF016:Sh3pxd2b UTSW 11 32,373,053 (GRCm39) small insertion probably benign
RF022:Sh3pxd2b UTSW 11 32,373,054 (GRCm39) small insertion probably benign
RF025:Sh3pxd2b UTSW 11 32,373,057 (GRCm39) small insertion probably benign
RF040:Sh3pxd2b UTSW 11 32,373,055 (GRCm39) small insertion probably benign
RF056:Sh3pxd2b UTSW 11 32,373,055 (GRCm39) small insertion probably benign
RF063:Sh3pxd2b UTSW 11 32,373,051 (GRCm39) small insertion probably benign
X0017:Sh3pxd2b UTSW 11 32,364,359 (GRCm39) missense possibly damaging 0.94
X0028:Sh3pxd2b UTSW 11 32,373,110 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCCTTCTAGGTGATTGAGAAGAGCC -3'
(R):5'- TCCTCGGACAGCTCAGCTTTAGAC -3'

Sequencing Primer
(F):5'- TTGAGAAGAGCCTAAGTGGTTG -3'
(R):5'- ATGTCATTTCTCAGCGGGAAC -3'
Posted On 2014-05-23