Incidental Mutation 'R1748:Adamts12'
ID194151
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 12
SynonymsAI605170; ADAMTS-12
MMRRC Submission 039780-MU
Accession Numbers

Genbank: NM_175501.2; MGI:2146046

Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R1748 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location11064790-11349231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 11241462 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 373 (M373I)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
Predicted Effect probably damaging
Transcript: ENSMUST00000061318
AA Change: M373I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: M373I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,333,588 Q1403K probably benign Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aire T C 10: 78,043,480 H15R probably damaging Het
Aldh3b2 T C 19: 3,977,572 F38L probably damaging Het
Alk A C 17: 72,603,421 C97G probably benign Het
Ano8 T C 8: 71,478,958 probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arsk T A 13: 76,062,410 H506L probably benign Het
Asgr2 G T 11: 70,096,832 R52L probably damaging Het
Atp2a1 A G 7: 126,459,608 I145T possibly damaging Het
Atrnl1 A G 19: 57,714,702 T1051A probably damaging Het
Cacna1e A T 1: 154,486,569 V424D possibly damaging Het
Capn3 T C 2: 120,497,013 V574A probably benign Het
Capzb C A 4: 139,257,368 D67E probably damaging Het
Ccdc68 A T 18: 69,955,991 T202S probably benign Het
Ccser2 T C 14: 36,896,313 K123R probably damaging Het
Ccser2 T A 14: 36,896,314 K123* probably null Het
Ces2h T C 8: 105,017,841 I316T probably benign Het
Chd3 T G 11: 69,364,697 K122Q possibly damaging Het
Col12a1 T C 9: 79,672,997 T1533A probably benign Het
Cr2 T A 1: 195,155,905 K1084* probably null Het
Ddx28 A G 8: 106,010,682 L248P probably benign Het
Depdc5 A G 5: 32,917,942 E488G probably benign Het
Dld T C 12: 31,334,746 T305A probably benign Het
Dok5 T A 2: 170,841,453 F211L probably damaging Het
Duox2 T C 2: 122,287,051 D934G probably benign Het
Eif3a G A 19: 60,766,798 T982I unknown Het
Erbb2 G T 11: 98,435,335 R979L probably benign Het
Espl1 G T 15: 102,298,529 V143L possibly damaging Het
Fanci T C 7: 79,430,488 L598P probably damaging Het
Fat2 T A 11: 55,256,647 E3923V probably damaging Het
Fhod3 A T 18: 24,770,493 K95* probably null Het
Gm16286 T C 18: 80,211,946 S152P probably benign Het
Gm7534 C G 4: 134,200,299 C381S probably damaging Het
Gm7534 T A 4: 134,202,119 T292S possibly damaging Het
Gpr108 G T 17: 57,236,217 T484K probably damaging Het
Hao1 T A 2: 134,498,318 N351I possibly damaging Het
Hepacam A T 9: 37,383,893 N308I possibly damaging Het
Herc2 T C 7: 56,148,823 probably null Het
Hltf T C 3: 20,076,521 I301T probably benign Het
Igsf10 A T 3: 59,319,093 N2386K probably damaging Het
Ikbke G T 1: 131,259,200 T585K probably benign Het
Iqgap3 A G 3: 88,113,980 T448A possibly damaging Het
Kl T C 5: 150,980,985 S401P possibly damaging Het
Lama4 T C 10: 39,065,619 V684A probably benign Het
Lgals8 A T 13: 12,454,943 F45Y probably damaging Het
Lgalsl G A 11: 20,826,491 R134C probably benign Het
Lmcd1 T C 6: 112,329,914 V349A probably benign Het
Lrp1b T A 2: 41,728,706 N119Y possibly damaging Het
Lrrc73 T A 17: 46,255,695 I157N probably damaging Het
Map3k8 A G 18: 4,334,766 Y293H probably damaging Het
Mybphl A T 3: 108,375,084 probably null Het
Ndrg1 A G 15: 66,931,081 M140T possibly damaging Het
Olfr138 T A 17: 38,275,106 C112S possibly damaging Het
Olfr885 A G 9: 38,061,500 Y60C probably damaging Het
Pbx2 T C 17: 34,593,977 S76P possibly damaging Het
Plcl2 T A 17: 50,606,798 S278R probably benign Het
Polr3d A T 14: 70,439,475 L393* probably null Het
Prmt6 T C 3: 110,250,367 Q202R probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sag T A 1: 87,831,940 I300N probably damaging Het
Sap25 T A 5: 137,641,918 probably null Het
Scarb2 A G 5: 92,460,836 L177P probably damaging Het
Sh3pxd2b A T 11: 32,422,203 N457Y possibly damaging Het
Siae T A 9: 37,631,606 probably null Het
Slc36a1 T C 11: 55,228,324 L375P probably damaging Het
Smg8 A G 11: 87,085,768 V329A probably damaging Het
Tas2r113 A T 6: 132,893,732 Y241F probably damaging Het
Tm9sf3 T G 19: 41,256,229 S70R probably benign Het
Tmem144 C T 3: 79,825,287 S228N probably damaging Het
Tmem45a C A 16: 56,822,338 V157F possibly damaging Het
Tpbg G T 9: 85,844,376 V133L probably damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ube2c T C 2: 164,771,321 F53S probably damaging Het
Vmn1r78 T A 7: 12,153,323 V287D probably damaging Het
Vmn2r114 T A 17: 23,308,061 D499V probably benign Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11311599 missense probably benign 0.00
IGL00513:Adamts12 APN 15 11256961 missense probably benign 0.28
IGL00579:Adamts12 APN 15 11152014 missense probably benign 0.20
IGL00984:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL01307:Adamts12 APN 15 11237546 missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11071853 missense probably benign 0.30
IGL01353:Adamts12 APN 15 11292005 splice site probably benign
IGL01373:Adamts12 APN 15 11310730 missense probably benign 0.00
IGL01522:Adamts12 APN 15 11065159 critical splice donor site probably null
IGL01589:Adamts12 APN 15 11311237 missense probably benign 0.26
IGL01715:Adamts12 APN 15 11258096 missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11258183 missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11345594 missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11215610 missense probably benign 0.01
IGL02216:Adamts12 APN 15 11241485 missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11311015 missense probably benign 0.01
IGL02336:Adamts12 APN 15 11311245 missense probably benign 0.02
IGL02445:Adamts12 APN 15 11286712 missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11263336 missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11345564 missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11292082 missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11241488 missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11071808 missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11286810 missense probably benign 0.33
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11217829 missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11285873 missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0108:Adamts12 UTSW 15 11311098 missense probably benign 0.08
R0122:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11071508 missense probably benign 0.11
R0308:Adamts12 UTSW 15 11311560 missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11311058 missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11215624 missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11255683 missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11277458 critical splice donor site probably null
R1173:Adamts12 UTSW 15 11071757 missense probably benign
R1174:Adamts12 UTSW 15 11071757 missense probably benign
R1319:Adamts12 UTSW 15 11286791 missense probably benign 0.02
R1344:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11256894 splice site probably benign
R1396:Adamts12 UTSW 15 11311472 missense probably benign 0.01
R1418:Adamts12 UTSW 15 11286804 missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11263361 missense probably benign 0.42
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1466:Adamts12 UTSW 15 11311359 missense probably benign
R1599:Adamts12 UTSW 15 11071711 missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11152057 missense probably benign 0.00
R1826:Adamts12 UTSW 15 11071520 missense probably benign 0.06
R1870:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1871:Adamts12 UTSW 15 11311154 missense probably benign 0.06
R1872:Adamts12 UTSW 15 11217880 nonsense probably null
R1931:Adamts12 UTSW 15 11270599 missense probably benign 0.00
R2041:Adamts12 UTSW 15 11215735 missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11310579 missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11215735 missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11065088 missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11286083 missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11071754 missense probably benign
R4666:Adamts12 UTSW 15 11311492 missense probably benign 0.08
R4731:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11270662 missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11285901 missense probably benign 0.03
R4877:Adamts12 UTSW 15 11327701 missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11259022 missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11299968 missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11285876 missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11327757 missense probably benign 0.18
R5492:Adamts12 UTSW 15 11336298 missense probably benign 0.05
R5580:Adamts12 UTSW 15 11152000 missense probably benign 0.14
R5645:Adamts12 UTSW 15 11277420 missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11286750 missense probably benign 0.15
R6240:Adamts12 UTSW 15 11285958 missense probably benign 0.44
R6331:Adamts12 UTSW 15 11241433 missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11256994 missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11255635 missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11215673 missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11065101 missense probably benign 0.00
R6821:Adamts12 UTSW 15 11152048 missense probably benign 0.14
R6913:Adamts12 UTSW 15 11215692 missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11331780 nonsense probably null
R7188:Adamts12 UTSW 15 11336325 nonsense probably null
R7290:Adamts12 UTSW 15 11277366 missense probably benign 0.08
R7307:Adamts12 UTSW 15 11217813 missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11277339 missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11317279 missense probably benign 0.00
R7484:Adamts12 UTSW 15 11345648 missense probably benign 0.25
R7562:Adamts12 UTSW 15 11270611 missense probably benign 0.01
R7653:Adamts12 UTSW 15 11257029 missense probably benign 0.28
R7696:Adamts12 UTSW 15 11258138 missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11317212 missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11263337 missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11310818 missense probably benign
R8032:Adamts12 UTSW 15 11259103 critical splice donor site probably null
R8109:Adamts12 UTSW 15 11331791 missense probably benign 0.02
R8402:Adamts12 UTSW 15 11263290 missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11215727 missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11237592 missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11299929 missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11285979 missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11317357 critical splice donor site probably null
V1662:Adamts12 UTSW 15 11071808 missense probably benign 0.13
X0022:Adamts12 UTSW 15 11277448 missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11336383 missense not run
Z1177:Adamts12 UTSW 15 11317324 missense probably damaging 1.00
Z1177:Adamts12 UTSW 15 11336383 missense not run
Predicted Primers PCR Primer
(F):5'- TCAGTCTCCCAAGATGATGAGCAAAAC -3'
(R):5'- TGTGCCATATGCCGAACTCAATCC -3'

Sequencing Primer
(F):5'- GAACTCAAAGCTGATTCCTGATTCC -3'
(R):5'- TATGCCGAACTCAATCCTCTGAC -3'
Posted On2014-05-23