Incidental Mutation 'R1748:Adamts12'
ID 194151
Institutional Source Beutler Lab
Gene Symbol Adamts12
Ensembl Gene ENSMUSG00000047497
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 12
Synonyms
MMRRC Submission 039780-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R1748 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 11064876-11349317 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 11241548 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 373 (M373I)
Ref Sequence ENSEMBL: ENSMUSP00000057796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061318]
AlphaFold Q811B3
Predicted Effect probably damaging
Transcript: ENSMUST00000061318
AA Change: M373I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000057796
Gene: ENSMUSG00000047497
AA Change: M373I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Pep_M12B_propep 53 197 5.5e-30 PFAM
low complexity region 236 245 N/A INTRINSIC
Pfam:Reprolysin_5 248 438 1.6e-14 PFAM
Pfam:Reprolysin_4 248 453 6.7e-8 PFAM
Pfam:Reprolysin 250 460 1.2e-27 PFAM
Pfam:Reprolysin_2 268 450 5.5e-11 PFAM
Pfam:Reprolysin_3 272 407 3.5e-10 PFAM
TSP1 549 601 9.29e-14 SMART
Pfam:ADAM_spacer1 706 817 4.8e-36 PFAM
TSP1 831 887 4.66e-5 SMART
TSP1 890 949 2.54e-1 SMART
TSP1 951 1001 8.95e-7 SMART
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
TSP1 1321 1371 2.22e-2 SMART
TSP1 1372 1431 9.97e-2 SMART
TSP1 1432 1479 1.19e-2 SMART
TSP1 1480 1538 2.63e-4 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Mice lacking the encoded protein exhibit increased angiogenic response and tumor invasion in different models of angiogenesis and, severe inflammation and delayed recovery when subjected to experimental conditions that induce colitis, endotoxic sepsis and pancreatitis. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased tumor vascularization, tumor invasion, and angiogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G T 16: 20,152,338 (GRCm39) Q1403K probably benign Het
Agrp G T 8: 106,293,467 (GRCm39) T106K probably damaging Het
Aire T C 10: 77,879,314 (GRCm39) H15R probably damaging Het
Aldh3b2 T C 19: 4,027,572 (GRCm39) F38L probably damaging Het
Alk A C 17: 72,910,416 (GRCm39) C97G probably benign Het
Ano8 T C 8: 71,931,602 (GRCm39) probably benign Het
Anpep C T 7: 79,488,004 (GRCm39) E518K probably benign Het
Arsk T A 13: 76,210,529 (GRCm39) H506L probably benign Het
Asgr2 G T 11: 69,987,658 (GRCm39) R52L probably damaging Het
Atp2a1 A G 7: 126,058,780 (GRCm39) I145T possibly damaging Het
Atrnl1 A G 19: 57,703,134 (GRCm39) T1051A probably damaging Het
Cacna1e A T 1: 154,362,315 (GRCm39) V424D possibly damaging Het
Capn3 T C 2: 120,327,494 (GRCm39) V574A probably benign Het
Capzb C A 4: 138,984,679 (GRCm39) D67E probably damaging Het
Ccdc68 A T 18: 70,089,062 (GRCm39) T202S probably benign Het
Ccser2 T C 14: 36,618,270 (GRCm39) K123R probably damaging Het
Ccser2 T A 14: 36,618,271 (GRCm39) K123* probably null Het
Ces2h T C 8: 105,744,473 (GRCm39) I316T probably benign Het
Chd3 T G 11: 69,255,523 (GRCm39) K122Q possibly damaging Het
Col12a1 T C 9: 79,580,279 (GRCm39) T1533A probably benign Het
Cr2 T A 1: 194,838,213 (GRCm39) K1084* probably null Het
Ddx28 A G 8: 106,737,314 (GRCm39) L248P probably benign Het
Depdc5 A G 5: 33,075,286 (GRCm39) E488G probably benign Het
Dld T C 12: 31,384,745 (GRCm39) T305A probably benign Het
Dok5 T A 2: 170,683,373 (GRCm39) F211L probably damaging Het
Duox2 T C 2: 122,117,532 (GRCm39) D934G probably benign Het
Eif3a G A 19: 60,755,236 (GRCm39) T982I unknown Het
Erbb2 G T 11: 98,326,161 (GRCm39) R979L probably benign Het
Espl1 G T 15: 102,206,964 (GRCm39) V143L possibly damaging Het
Fanci T C 7: 79,080,236 (GRCm39) L598P probably damaging Het
Fat2 T A 11: 55,147,473 (GRCm39) E3923V probably damaging Het
Fhod3 A T 18: 24,903,550 (GRCm39) K95* probably null Het
Gpr108 G T 17: 57,543,217 (GRCm39) T484K probably damaging Het
Hao1 T A 2: 134,340,238 (GRCm39) N351I possibly damaging Het
Hepacam A T 9: 37,295,189 (GRCm39) N308I possibly damaging Het
Herc2 T C 7: 55,798,571 (GRCm39) probably null Het
Hltf T C 3: 20,130,685 (GRCm39) I301T probably benign Het
Igsf10 A T 3: 59,226,514 (GRCm39) N2386K probably damaging Het
Ikbke G T 1: 131,186,937 (GRCm39) T585K probably benign Het
Iqgap3 A G 3: 88,021,287 (GRCm39) T448A possibly damaging Het
Kl T C 5: 150,904,450 (GRCm39) S401P possibly damaging Het
Lama4 T C 10: 38,941,615 (GRCm39) V684A probably benign Het
Lgals8 A T 13: 12,469,824 (GRCm39) F45Y probably damaging Het
Lgalsl G A 11: 20,776,491 (GRCm39) R134C probably benign Het
Lmcd1 T C 6: 112,306,875 (GRCm39) V349A probably benign Het
Lrp1b T A 2: 41,618,718 (GRCm39) N119Y possibly damaging Het
Lrrc73 T A 17: 46,566,621 (GRCm39) I157N probably damaging Het
Map3k8 A G 18: 4,334,766 (GRCm39) Y293H probably damaging Het
Mybphl A T 3: 108,282,400 (GRCm39) probably null Het
Naa12 T C 18: 80,255,161 (GRCm39) S152P probably benign Het
Ndrg1 A G 15: 66,802,930 (GRCm39) M140T possibly damaging Het
Or2n1e T A 17: 38,585,997 (GRCm39) C112S possibly damaging Het
Or8b38 A G 9: 37,972,796 (GRCm39) Y60C probably damaging Het
Pbx2 T C 17: 34,812,951 (GRCm39) S76P possibly damaging Het
Plcl2 T A 17: 50,913,826 (GRCm39) S278R probably benign Het
Polr3d A T 14: 70,676,915 (GRCm39) L393* probably null Het
Prmt6 T C 3: 110,157,683 (GRCm39) Q202R probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Sag T A 1: 87,759,662 (GRCm39) I300N probably damaging Het
Sap25 T A 5: 137,640,180 (GRCm39) probably null Het
Scarb2 A G 5: 92,608,695 (GRCm39) L177P probably damaging Het
Sh3pxd2b A T 11: 32,372,203 (GRCm39) N457Y possibly damaging Het
Siae T A 9: 37,542,902 (GRCm39) probably null Het
Slc36a1 T C 11: 55,119,150 (GRCm39) L375P probably damaging Het
Smg8 A G 11: 86,976,594 (GRCm39) V329A probably damaging Het
Tas2r113 A T 6: 132,870,695 (GRCm39) Y241F probably damaging Het
Tm9sf3 T G 19: 41,244,668 (GRCm39) S70R probably benign Het
Tmem144 C T 3: 79,732,594 (GRCm39) S228N probably damaging Het
Tmem45a C A 16: 56,642,701 (GRCm39) V157F possibly damaging Het
Tpbg G T 9: 85,726,429 (GRCm39) V133L probably damaging Het
Trpv3 G A 11: 73,186,209 (GRCm39) V667I possibly damaging Het
Ube2c T C 2: 164,613,241 (GRCm39) F53S probably damaging Het
Vmn1r78 T A 7: 11,887,250 (GRCm39) V287D probably damaging Het
Vmn2r114 T A 17: 23,527,035 (GRCm39) D499V probably benign Het
Zpld2 C G 4: 133,927,610 (GRCm39) C381S probably damaging Het
Zpld2 T A 4: 133,929,430 (GRCm39) T292S possibly damaging Het
Other mutations in Adamts12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Adamts12 APN 15 11,311,685 (GRCm39) missense probably benign 0.00
IGL00513:Adamts12 APN 15 11,257,047 (GRCm39) missense probably benign 0.28
IGL00579:Adamts12 APN 15 11,152,100 (GRCm39) missense probably benign 0.20
IGL00984:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL01307:Adamts12 APN 15 11,237,632 (GRCm39) missense possibly damaging 0.88
IGL01314:Adamts12 APN 15 11,071,939 (GRCm39) missense probably benign 0.30
IGL01353:Adamts12 APN 15 11,292,091 (GRCm39) splice site probably benign
IGL01373:Adamts12 APN 15 11,310,816 (GRCm39) missense probably benign 0.00
IGL01522:Adamts12 APN 15 11,065,245 (GRCm39) critical splice donor site probably null
IGL01589:Adamts12 APN 15 11,311,323 (GRCm39) missense probably benign 0.26
IGL01715:Adamts12 APN 15 11,258,182 (GRCm39) missense possibly damaging 0.47
IGL01966:Adamts12 APN 15 11,258,269 (GRCm39) missense probably damaging 0.98
IGL01994:Adamts12 APN 15 11,345,680 (GRCm39) missense probably damaging 1.00
IGL02058:Adamts12 APN 15 11,215,696 (GRCm39) missense probably benign 0.01
IGL02216:Adamts12 APN 15 11,241,571 (GRCm39) missense possibly damaging 0.63
IGL02252:Adamts12 APN 15 11,311,101 (GRCm39) missense probably benign 0.01
IGL02336:Adamts12 APN 15 11,311,331 (GRCm39) missense probably benign 0.02
IGL02445:Adamts12 APN 15 11,286,798 (GRCm39) missense probably damaging 1.00
IGL03115:Adamts12 APN 15 11,263,422 (GRCm39) missense probably damaging 1.00
IGL03131:Adamts12 APN 15 11,345,650 (GRCm39) missense probably damaging 1.00
IGL03161:Adamts12 APN 15 11,292,168 (GRCm39) missense possibly damaging 0.93
IGL03403:Adamts12 APN 15 11,241,574 (GRCm39) missense probably damaging 1.00
I2289:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
PIT4677001:Adamts12 UTSW 15 11,286,896 (GRCm39) missense probably benign 0.33
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0016:Adamts12 UTSW 15 11,217,915 (GRCm39) missense probably damaging 1.00
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0027:Adamts12 UTSW 15 11,285,959 (GRCm39) missense probably damaging 0.99
R0028:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0108:Adamts12 UTSW 15 11,311,184 (GRCm39) missense probably benign 0.08
R0122:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0196:Adamts12 UTSW 15 11,071,594 (GRCm39) missense probably benign 0.11
R0308:Adamts12 UTSW 15 11,311,646 (GRCm39) missense probably damaging 0.98
R0335:Adamts12 UTSW 15 11,311,144 (GRCm39) missense possibly damaging 0.95
R0667:Adamts12 UTSW 15 11,215,710 (GRCm39) missense probably damaging 1.00
R0729:Adamts12 UTSW 15 11,255,769 (GRCm39) missense possibly damaging 0.91
R1162:Adamts12 UTSW 15 11,277,544 (GRCm39) critical splice donor site probably null
R1173:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1174:Adamts12 UTSW 15 11,071,843 (GRCm39) missense probably benign
R1319:Adamts12 UTSW 15 11,286,877 (GRCm39) missense probably benign 0.02
R1344:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1367:Adamts12 UTSW 15 11,256,980 (GRCm39) splice site probably benign
R1396:Adamts12 UTSW 15 11,311,558 (GRCm39) missense probably benign 0.01
R1418:Adamts12 UTSW 15 11,286,890 (GRCm39) missense probably damaging 1.00
R1447:Adamts12 UTSW 15 11,263,447 (GRCm39) missense probably benign 0.42
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1466:Adamts12 UTSW 15 11,311,445 (GRCm39) missense probably benign
R1599:Adamts12 UTSW 15 11,071,797 (GRCm39) missense probably damaging 0.99
R1700:Adamts12 UTSW 15 11,152,143 (GRCm39) missense probably benign 0.00
R1826:Adamts12 UTSW 15 11,071,606 (GRCm39) missense probably benign 0.06
R1870:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1871:Adamts12 UTSW 15 11,311,240 (GRCm39) missense probably benign 0.06
R1872:Adamts12 UTSW 15 11,217,966 (GRCm39) nonsense probably null
R1931:Adamts12 UTSW 15 11,270,685 (GRCm39) missense probably benign 0.00
R2041:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 1.00
R2119:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2120:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2122:Adamts12 UTSW 15 11,310,665 (GRCm39) missense probably damaging 1.00
R2161:Adamts12 UTSW 15 11,215,821 (GRCm39) missense probably damaging 0.99
R2655:Adamts12 UTSW 15 11,065,174 (GRCm39) missense possibly damaging 0.50
R4010:Adamts12 UTSW 15 11,286,169 (GRCm39) missense possibly damaging 0.69
R4208:Adamts12 UTSW 15 11,071,840 (GRCm39) missense probably benign
R4666:Adamts12 UTSW 15 11,311,578 (GRCm39) missense probably benign 0.08
R4731:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4732:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4733:Adamts12 UTSW 15 11,270,748 (GRCm39) missense probably damaging 1.00
R4766:Adamts12 UTSW 15 11,285,987 (GRCm39) missense probably benign 0.03
R4877:Adamts12 UTSW 15 11,327,787 (GRCm39) missense probably damaging 1.00
R4929:Adamts12 UTSW 15 11,259,108 (GRCm39) missense probably damaging 0.96
R5060:Adamts12 UTSW 15 11,300,054 (GRCm39) missense probably damaging 1.00
R5145:Adamts12 UTSW 15 11,285,962 (GRCm39) missense probably damaging 1.00
R5191:Adamts12 UTSW 15 11,327,843 (GRCm39) missense probably benign 0.18
R5492:Adamts12 UTSW 15 11,336,384 (GRCm39) missense probably benign 0.05
R5580:Adamts12 UTSW 15 11,152,086 (GRCm39) missense probably benign 0.14
R5645:Adamts12 UTSW 15 11,277,506 (GRCm39) missense possibly damaging 0.92
R5724:Adamts12 UTSW 15 11,286,836 (GRCm39) missense probably benign 0.15
R6240:Adamts12 UTSW 15 11,286,044 (GRCm39) missense probably benign 0.44
R6331:Adamts12 UTSW 15 11,241,519 (GRCm39) missense probably damaging 1.00
R6381:Adamts12 UTSW 15 11,257,080 (GRCm39) missense possibly damaging 0.93
R6393:Adamts12 UTSW 15 11,255,721 (GRCm39) missense probably damaging 0.97
R6419:Adamts12 UTSW 15 11,215,759 (GRCm39) missense possibly damaging 0.72
R6571:Adamts12 UTSW 15 11,065,187 (GRCm39) missense probably benign 0.00
R6821:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.14
R6913:Adamts12 UTSW 15 11,215,778 (GRCm39) missense probably damaging 1.00
R6973:Adamts12 UTSW 15 11,331,866 (GRCm39) nonsense probably null
R7188:Adamts12 UTSW 15 11,336,411 (GRCm39) nonsense probably null
R7290:Adamts12 UTSW 15 11,277,452 (GRCm39) missense probably benign 0.08
R7307:Adamts12 UTSW 15 11,217,899 (GRCm39) missense probably damaging 1.00
R7376:Adamts12 UTSW 15 11,277,425 (GRCm39) missense possibly damaging 0.69
R7419:Adamts12 UTSW 15 11,317,365 (GRCm39) missense probably benign 0.00
R7484:Adamts12 UTSW 15 11,345,734 (GRCm39) missense probably benign 0.25
R7562:Adamts12 UTSW 15 11,270,697 (GRCm39) missense probably benign 0.01
R7653:Adamts12 UTSW 15 11,257,115 (GRCm39) missense probably benign 0.28
R7696:Adamts12 UTSW 15 11,258,224 (GRCm39) missense probably damaging 1.00
R7957:Adamts12 UTSW 15 11,317,298 (GRCm39) missense possibly damaging 0.96
R7980:Adamts12 UTSW 15 11,263,423 (GRCm39) missense probably damaging 1.00
R7992:Adamts12 UTSW 15 11,310,904 (GRCm39) missense probably benign
R8032:Adamts12 UTSW 15 11,259,189 (GRCm39) critical splice donor site probably null
R8109:Adamts12 UTSW 15 11,331,877 (GRCm39) missense probably benign 0.02
R8402:Adamts12 UTSW 15 11,263,376 (GRCm39) missense probably damaging 0.96
R8751:Adamts12 UTSW 15 11,215,813 (GRCm39) missense probably damaging 1.00
R8782:Adamts12 UTSW 15 11,237,678 (GRCm39) missense probably damaging 1.00
R8934:Adamts12 UTSW 15 11,300,015 (GRCm39) missense probably damaging 0.99
R8952:Adamts12 UTSW 15 11,286,065 (GRCm39) missense probably damaging 1.00
R8963:Adamts12 UTSW 15 11,317,443 (GRCm39) critical splice donor site probably null
R9042:Adamts12 UTSW 15 11,152,134 (GRCm39) missense probably benign 0.08
R9162:Adamts12 UTSW 15 11,311,721 (GRCm39) missense probably benign 0.29
R9190:Adamts12 UTSW 15 11,336,446 (GRCm39) missense probably benign 0.02
R9700:Adamts12 UTSW 15 11,311,442 (GRCm39) missense probably benign 0.04
R9748:Adamts12 UTSW 15 11,310,628 (GRCm39) missense probably damaging 0.99
V1662:Adamts12 UTSW 15 11,071,894 (GRCm39) missense probably benign 0.13
X0022:Adamts12 UTSW 15 11,277,534 (GRCm39) missense probably benign 0.30
Z1176:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,336,469 (GRCm39) missense not run
Z1177:Adamts12 UTSW 15 11,317,410 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTCTCCCAAGATGATGAGCAAAAC -3'
(R):5'- TGTGCCATATGCCGAACTCAATCC -3'

Sequencing Primer
(F):5'- GAACTCAAAGCTGATTCCTGATTCC -3'
(R):5'- TATGCCGAACTCAATCCTCTGAC -3'
Posted On 2014-05-23