Mutagenetix > Incidental Mutation

Incidental Mutation 'R1748:Espl1'

194153

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

039780-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1748 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 102298529 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Leucine at position 143 (V143L)

Ref Sequence

ENSEMBL: ENSMUSP00000155074 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050] [ENSMUST00000230212] [ENSMUST00000231104]

AlphaFold

P60330

Predicted Effect

probably benign
Transcript: ENSMUST00000064924
AA Change: V143L

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: V143L

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000229050
AA Change: V143L

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000229580

Predicted Effect

possibly damaging
Transcript: ENSMUST00000230212
AA Change: V143L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

probably benign
Transcript: ENSMUST00000231104

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	T	16: 20,333,588	Q1403K	probably benign	Het
Adamts12	G	A	15: 11,241,462	M373I	probably damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Aire	T	C	10: 78,043,480	H15R	probably damaging	Het
Aldh3b2	T	C	19: 3,977,572	F38L	probably damaging	Het
Alk	A	C	17: 72,603,421	C97G	probably benign	Het
Ano8	T	C	8: 71,478,958		probably benign	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arsk	T	A	13: 76,062,410	H506L	probably benign	Het
Asgr2	G	T	11: 70,096,832	R52L	probably damaging	Het
Atp2a1	A	G	7: 126,459,608	I145T	possibly damaging	Het
Atrnl1	A	G	19: 57,714,702	T1051A	probably damaging	Het
Cacna1e	A	T	1: 154,486,569	V424D	possibly damaging	Het
Capn3	T	C	2: 120,497,013	V574A	probably benign	Het
Capzb	C	A	4: 139,257,368	D67E	probably damaging	Het
Ccdc68	A	T	18: 69,955,991	T202S	probably benign	Het
Ccser2	T	A	14: 36,896,314	K123*	probably null	Het
Ccser2	T	C	14: 36,896,313	K123R	probably damaging	Het
Ces2h	T	C	8: 105,017,841	I316T	probably benign	Het
Chd3	T	G	11: 69,364,697	K122Q	possibly damaging	Het
Col12a1	T	C	9: 79,672,997	T1533A	probably benign	Het
Cr2	T	A	1: 195,155,905	K1084*	probably null	Het
Ddx28	A	G	8: 106,010,682	L248P	probably benign	Het
Depdc5	A	G	5: 32,917,942	E488G	probably benign	Het
Dld	T	C	12: 31,334,746	T305A	probably benign	Het
Dok5	T	A	2: 170,841,453	F211L	probably damaging	Het
Duox2	T	C	2: 122,287,051	D934G	probably benign	Het
Eif3a	G	A	19: 60,766,798	T982I	unknown	Het
Erbb2	G	T	11: 98,435,335	R979L	probably benign	Het
Fanci	T	C	7: 79,430,488	L598P	probably damaging	Het
Fat2	T	A	11: 55,256,647	E3923V	probably damaging	Het
Fhod3	A	T	18: 24,770,493	K95*	probably null	Het
Gm16286	T	C	18: 80,211,946	S152P	probably benign	Het
Gm7534	C	G	4: 134,200,299	C381S	probably damaging	Het
Gm7534	T	A	4: 134,202,119	T292S	possibly damaging	Het
Gpr108	G	T	17: 57,236,217	T484K	probably damaging	Het
Hao1	T	A	2: 134,498,318	N351I	possibly damaging	Het
Hepacam	A	T	9: 37,383,893	N308I	possibly damaging	Het
Herc2	T	C	7: 56,148,823		probably null	Het
Hltf	T	C	3: 20,076,521	I301T	probably benign	Het
Igsf10	A	T	3: 59,319,093	N2386K	probably damaging	Het
Ikbke	G	T	1: 131,259,200	T585K	probably benign	Het
Iqgap3	A	G	3: 88,113,980	T448A	possibly damaging	Het
Kl	T	C	5: 150,980,985	S401P	possibly damaging	Het
Lama4	T	C	10: 39,065,619	V684A	probably benign	Het
Lgals8	A	T	13: 12,454,943	F45Y	probably damaging	Het
Lgalsl	G	A	11: 20,826,491	R134C	probably benign	Het
Lmcd1	T	C	6: 112,329,914	V349A	probably benign	Het
Lrp1b	T	A	2: 41,728,706	N119Y	possibly damaging	Het
Lrrc73	T	A	17: 46,255,695	I157N	probably damaging	Het
Map3k8	A	G	18: 4,334,766	Y293H	probably damaging	Het
Mybphl	A	T	3: 108,375,084		probably null	Het
Ndrg1	A	G	15: 66,931,081	M140T	possibly damaging	Het
Olfr138	T	A	17: 38,275,106	C112S	possibly damaging	Het
Olfr885	A	G	9: 38,061,500	Y60C	probably damaging	Het
Pbx2	T	C	17: 34,593,977	S76P	possibly damaging	Het
Plcl2	T	A	17: 50,606,798	S278R	probably benign	Het
Polr3d	A	T	14: 70,439,475	L393*	probably null	Het
Prmt6	T	C	3: 110,250,367	Q202R	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sag	T	A	1: 87,831,940	I300N	probably damaging	Het
Sap25	T	A	5: 137,641,918		probably null	Het
Scarb2	A	G	5: 92,460,836	L177P	probably damaging	Het
Sh3pxd2b	A	T	11: 32,422,203	N457Y	possibly damaging	Het
Siae	T	A	9: 37,631,606		probably null	Het
Slc36a1	T	C	11: 55,228,324	L375P	probably damaging	Het
Smg8	A	G	11: 87,085,768	V329A	probably damaging	Het
Tas2r113	A	T	6: 132,893,732	Y241F	probably damaging	Het
Tm9sf3	T	G	19: 41,256,229	S70R	probably benign	Het
Tmem144	C	T	3: 79,825,287	S228N	probably damaging	Het
Tmem45a	C	A	16: 56,822,338	V157F	possibly damaging	Het
Tpbg	G	T	9: 85,844,376	V133L	probably damaging	Het
Trpv3	G	A	11: 73,295,383	V667I	possibly damaging	Het
Ube2c	T	C	2: 164,771,321	F53S	probably damaging	Het
Vmn1r78	T	A	7: 12,153,323	V287D	probably damaging	Het
Vmn2r114	T	A	17: 23,308,061	D499V	probably benign	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7135:Espl1	UTSW	15	102319524	nonsense	probably null
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCACCTGAGGAGTATTTTGGAC -3'
(R):5'- GCTGATAGGCGGCAACTAAACGAC -3'

Sequencing Primer
(F):5'- ATTTTGGACCTGGCAGAGC -3'
(R):5'- CTAAACGACAGGCGGTTGG -3'

Posted On

2014-05-23