Incidental Mutation 'R1748:Abcc5'
ID194154
Institutional Source Beutler Lab
Gene Symbol Abcc5
Ensembl Gene ENSMUSG00000022822
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 5
Synonyms2900011L11Rik, Abcc5a, Mrp5, Abcc5b
MMRRC Submission 039780-MU
Accession Numbers

Ncbi RefSeq: NM_013790.2, NM_176839.1; MGI:1351644

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1748 (G1)
Quality Score224
Status Not validated
Chromosome16
Chromosomal Location20331303-20426394 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20333588 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 1403 (Q1403K)
Ref Sequence ENSEMBL: ENSMUSP00000111209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079158] [ENSMUST00000115547]
Predicted Effect probably benign
Transcript: ENSMUST00000079158
AA Change: Q1403K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000078158
Gene: ENSMUSG00000022822
AA Change: Q1403K

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 1.6e-18 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1142 9.3e-36 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115547
AA Change: Q1403K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000111209
Gene: ENSMUSG00000022822
AA Change: Q1403K

DomainStartEndE-ValueType
Pfam:ABC_membrane 179 447 2e-17 PFAM
low complexity region 552 563 N/A INTRINSIC
AAA 587 760 1.16e-12 SMART
low complexity region 815 826 N/A INTRINSIC
Pfam:ABC_membrane 858 1146 6.5e-30 PFAM
AAA 1218 1403 1.26e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134413
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype Strain: 3794119
FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The human protein functions in the cellular export of its substrate, cyclic nucleotides. This export contributes to the degradation of phosphodiesterases and possibly an elimination pathway for cyclic nucleotides. Studies show that the human protein provides resistance to thiopurine anticancer drugs, 6-mercatopurine and thioguanine, and the anti-HIV drug 9-(2-phosphonylmethoxyethyl)adenine. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display normal cGMP transport into erythrocyte membrane vesicles. [provided by MGI curators]
Allele List at MGI

All alleles(81) : Targeted(4) Gene trapped(77)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 G A 15: 11,241,462 M373I probably damaging Het
Agrp G T 8: 105,566,835 T106K probably damaging Het
Aire T C 10: 78,043,480 H15R probably damaging Het
Aldh3b2 T C 19: 3,977,572 F38L probably damaging Het
Alk A C 17: 72,603,421 C97G probably benign Het
Ano8 T C 8: 71,478,958 probably benign Het
Anpep C T 7: 79,838,256 E518K probably benign Het
Arsk T A 13: 76,062,410 H506L probably benign Het
Asgr2 G T 11: 70,096,832 R52L probably damaging Het
Atp2a1 A G 7: 126,459,608 I145T possibly damaging Het
Atrnl1 A G 19: 57,714,702 T1051A probably damaging Het
Cacna1e A T 1: 154,486,569 V424D possibly damaging Het
Capn3 T C 2: 120,497,013 V574A probably benign Het
Capzb C A 4: 139,257,368 D67E probably damaging Het
Ccdc68 A T 18: 69,955,991 T202S probably benign Het
Ccser2 T C 14: 36,896,313 K123R probably damaging Het
Ccser2 T A 14: 36,896,314 K123* probably null Het
Ces2h T C 8: 105,017,841 I316T probably benign Het
Chd3 T G 11: 69,364,697 K122Q possibly damaging Het
Col12a1 T C 9: 79,672,997 T1533A probably benign Het
Cr2 T A 1: 195,155,905 K1084* probably null Het
Ddx28 A G 8: 106,010,682 L248P probably benign Het
Depdc5 A G 5: 32,917,942 E488G probably benign Het
Dld T C 12: 31,334,746 T305A probably benign Het
Dok5 T A 2: 170,841,453 F211L probably damaging Het
Duox2 T C 2: 122,287,051 D934G probably benign Het
Eif3a G A 19: 60,766,798 T982I unknown Het
Erbb2 G T 11: 98,435,335 R979L probably benign Het
Espl1 G T 15: 102,298,529 V143L possibly damaging Het
Fanci T C 7: 79,430,488 L598P probably damaging Het
Fat2 T A 11: 55,256,647 E3923V probably damaging Het
Fhod3 A T 18: 24,770,493 K95* probably null Het
Gm16286 T C 18: 80,211,946 S152P probably benign Het
Gm7534 C G 4: 134,200,299 C381S probably damaging Het
Gm7534 T A 4: 134,202,119 T292S possibly damaging Het
Gpr108 G T 17: 57,236,217 T484K probably damaging Het
Hao1 T A 2: 134,498,318 N351I possibly damaging Het
Hepacam A T 9: 37,383,893 N308I possibly damaging Het
Herc2 T C 7: 56,148,823 probably null Het
Hltf T C 3: 20,076,521 I301T probably benign Het
Igsf10 A T 3: 59,319,093 N2386K probably damaging Het
Ikbke G T 1: 131,259,200 T585K probably benign Het
Iqgap3 A G 3: 88,113,980 T448A possibly damaging Het
Kl T C 5: 150,980,985 S401P possibly damaging Het
Lama4 T C 10: 39,065,619 V684A probably benign Het
Lgals8 A T 13: 12,454,943 F45Y probably damaging Het
Lgalsl G A 11: 20,826,491 R134C probably benign Het
Lmcd1 T C 6: 112,329,914 V349A probably benign Het
Lrp1b T A 2: 41,728,706 N119Y possibly damaging Het
Lrrc73 T A 17: 46,255,695 I157N probably damaging Het
Map3k8 A G 18: 4,334,766 Y293H probably damaging Het
Mybphl A T 3: 108,375,084 probably null Het
Ndrg1 A G 15: 66,931,081 M140T possibly damaging Het
Olfr138 T A 17: 38,275,106 C112S possibly damaging Het
Olfr885 A G 9: 38,061,500 Y60C probably damaging Het
Pbx2 T C 17: 34,593,977 S76P possibly damaging Het
Plcl2 T A 17: 50,606,798 S278R probably benign Het
Polr3d A T 14: 70,439,475 L393* probably null Het
Prmt6 T C 3: 110,250,367 Q202R probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Sag T A 1: 87,831,940 I300N probably damaging Het
Sap25 T A 5: 137,641,918 probably null Het
Scarb2 A G 5: 92,460,836 L177P probably damaging Het
Sh3pxd2b A T 11: 32,422,203 N457Y possibly damaging Het
Siae T A 9: 37,631,606 probably null Het
Slc36a1 T C 11: 55,228,324 L375P probably damaging Het
Smg8 A G 11: 87,085,768 V329A probably damaging Het
Tas2r113 A T 6: 132,893,732 Y241F probably damaging Het
Tm9sf3 T G 19: 41,256,229 S70R probably benign Het
Tmem144 C T 3: 79,825,287 S228N probably damaging Het
Tmem45a C A 16: 56,822,338 V157F possibly damaging Het
Tpbg G T 9: 85,844,376 V133L probably damaging Het
Trpv3 G A 11: 73,295,383 V667I possibly damaging Het
Ube2c T C 2: 164,771,321 F53S probably damaging Het
Vmn1r78 T A 7: 12,153,323 V287D probably damaging Het
Vmn2r114 T A 17: 23,308,061 D499V probably benign Het
Other mutations in Abcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Abcc5 APN 16 20422357 missense probably benign 0.01
IGL00928:Abcc5 APN 16 20398970 unclassified probably benign
IGL01350:Abcc5 APN 16 20368458 missense probably benign 0.00
IGL01774:Abcc5 APN 16 20378457 missense probably damaging 1.00
IGL01934:Abcc5 APN 16 20422441 utr 5 prime probably benign
IGL02413:Abcc5 APN 16 20422437 utr 5 prime probably benign
IGL02426:Abcc5 APN 16 20338925 missense probably damaging 0.98
IGL02797:Abcc5 APN 16 20368464 missense probably benign 0.06
IGL02938:Abcc5 APN 16 20362229 missense possibly damaging 0.64
IGL03367:Abcc5 APN 16 20392811 utr 3 prime probably benign
IGL03411:Abcc5 APN 16 20399560 missense probably damaging 0.97
PIT4508001:Abcc5 UTSW 16 20357378 missense probably damaging 0.97
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0021:Abcc5 UTSW 16 20378661 nonsense probably null
R0220:Abcc5 UTSW 16 20369102 missense probably benign
R0281:Abcc5 UTSW 16 20422400 missense probably damaging 1.00
R0401:Abcc5 UTSW 16 20376558 missense probably benign 0.09
R0448:Abcc5 UTSW 16 20399937 missense probably damaging 1.00
R0477:Abcc5 UTSW 16 20368569 missense possibly damaging 0.51
R0477:Abcc5 UTSW 16 20398885 missense probably damaging 0.96
R0601:Abcc5 UTSW 16 20404559 splice site probably benign
R0648:Abcc5 UTSW 16 20365882 missense possibly damaging 0.90
R0709:Abcc5 UTSW 16 20376592 missense possibly damaging 0.91
R1144:Abcc5 UTSW 16 20422438 utr 5 prime probably benign
R1552:Abcc5 UTSW 16 20398867 missense probably damaging 0.99
R1625:Abcc5 UTSW 16 20365817 missense probably damaging 0.99
R1789:Abcc5 UTSW 16 20365951 missense probably damaging 1.00
R1801:Abcc5 UTSW 16 20338887 missense probably benign 0.43
R1909:Abcc5 UTSW 16 20376509 critical splice donor site probably null
R2046:Abcc5 UTSW 16 20399817 missense possibly damaging 0.90
R2203:Abcc5 UTSW 16 20405882 missense possibly damaging 0.91
R3031:Abcc5 UTSW 16 20375113 missense probably damaging 0.99
R3417:Abcc5 UTSW 16 20405552 splice site probably benign
R3708:Abcc5 UTSW 16 20372180 missense probably benign 0.30
R3731:Abcc5 UTSW 16 20398934 nonsense probably null
R3829:Abcc5 UTSW 16 20365865 missense probably benign 0.00
R3847:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3850:Abcc5 UTSW 16 20372156 missense probably benign 0.12
R3955:Abcc5 UTSW 16 20405543 missense probably damaging 0.97
R4072:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4432:Abcc5 UTSW 16 20368187 intron probably null
R4433:Abcc5 UTSW 16 20368187 intron probably null
R4505:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4506:Abcc5 UTSW 16 20333695 missense probably damaging 1.00
R4715:Abcc5 UTSW 16 20398876 missense probably damaging 1.00
R4739:Abcc5 UTSW 16 20399626 missense probably damaging 1.00
R4866:Abcc5 UTSW 16 20422432 start codon destroyed probably null 1.00
R4905:Abcc5 UTSW 16 20399928 missense probably damaging 1.00
R4907:Abcc5 UTSW 16 20376546 missense possibly damaging 0.86
R5088:Abcc5 UTSW 16 20376662 missense probably damaging 1.00
R5232:Abcc5 UTSW 16 20338922 missense probably damaging 0.96
R5559:Abcc5 UTSW 16 20338886 missense probably damaging 1.00
R5647:Abcc5 UTSW 16 20399847 missense probably damaging 1.00
R5861:Abcc5 UTSW 16 20399894 missense probably damaging 1.00
R6190:Abcc5 UTSW 16 20392779 missense probably benign 0.02
R6213:Abcc5 UTSW 16 20400012 missense probably damaging 1.00
R6511:Abcc5 UTSW 16 20376594 missense probably damaging 0.99
R6732:Abcc5 UTSW 16 20404684 missense probably benign 0.01
R6815:Abcc5 UTSW 16 20333630 missense probably damaging 1.00
R6913:Abcc5 UTSW 16 20378744 missense possibly damaging 0.73
R6945:Abcc5 UTSW 16 20400009 missense probably benign
R7167:Abcc5 UTSW 16 20405501 missense possibly damaging 0.70
R7276:Abcc5 UTSW 16 20376508 splice site probably null
R7318:Abcc5 UTSW 16 20392543 missense probably benign 0.01
R7380:Abcc5 UTSW 16 20397034 missense possibly damaging 0.84
R7419:Abcc5 UTSW 16 20422423 missense possibly damaging 0.57
R7451:Abcc5 UTSW 16 20375070 missense probably damaging 1.00
R7475:Abcc5 UTSW 16 20399989 missense probably benign 0.04
R7567:Abcc5 UTSW 16 20405510 missense probably damaging 1.00
R7601:Abcc5 UTSW 16 20375132 nonsense probably null
R7623:Abcc5 UTSW 16 20344696 missense possibly damaging 0.95
R7682:Abcc5 UTSW 16 20368053 missense probably damaging 1.00
R8128:Abcc5 UTSW 16 20365723 missense probably damaging 0.98
X0022:Abcc5 UTSW 16 20392587 missense probably damaging 1.00
X0053:Abcc5 UTSW 16 20364042 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCACAGGAGAGTAAGAGCATCC -3'
(R):5'- ATTGCAAACAGGCCGAGAGCAC -3'

Sequencing Primer
(F):5'- TGCTATGGCTGCTTGGTGAA -3'
(R):5'- GCAAAGGGCATTTTCACGTC -3'
Posted On2014-05-23