Mutagenetix > Incidental Mutation

Incidental Mutation 'R1748:Vmn2r114'

194156

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r114

Ensembl Gene

ENSMUSG00000091945

Gene Name

vomeronasal 2, receptor 114

Synonyms

EG666002

MMRRC Submission

039780-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R1748 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23290934-23312313 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 23308061 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 499 (D499V)

Ref Sequence

ENSEMBL: ENSMUSP00000127505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168033]

AlphaFold

E9Q281

Predicted Effect

probably benign
Transcript: ENSMUST00000168033
AA Change: D499V

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000127505
Gene: ENSMUSG00000091945
AA Change: D499V

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	154	470	1.5e-24	PFAM
Pfam:NCD3G	511	564	1.5e-18	PFAM
Pfam:7tm_3	597	832	1.4e-55	PFAM

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	T	16: 20,333,588	Q1403K	probably benign	Het
Adamts12	G	A	15: 11,241,462	M373I	probably damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Aire	T	C	10: 78,043,480	H15R	probably damaging	Het
Aldh3b2	T	C	19: 3,977,572	F38L	probably damaging	Het
Alk	A	C	17: 72,603,421	C97G	probably benign	Het
Ano8	T	C	8: 71,478,958		probably benign	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arsk	T	A	13: 76,062,410	H506L	probably benign	Het
Asgr2	G	T	11: 70,096,832	R52L	probably damaging	Het
Atp2a1	A	G	7: 126,459,608	I145T	possibly damaging	Het
Atrnl1	A	G	19: 57,714,702	T1051A	probably damaging	Het
Cacna1e	A	T	1: 154,486,569	V424D	possibly damaging	Het
Capn3	T	C	2: 120,497,013	V574A	probably benign	Het
Capzb	C	A	4: 139,257,368	D67E	probably damaging	Het
Ccdc68	A	T	18: 69,955,991	T202S	probably benign	Het
Ccser2	T	C	14: 36,896,313	K123R	probably damaging	Het
Ccser2	T	A	14: 36,896,314	K123*	probably null	Het
Ces2h	T	C	8: 105,017,841	I316T	probably benign	Het
Chd3	T	G	11: 69,364,697	K122Q	possibly damaging	Het
Col12a1	T	C	9: 79,672,997	T1533A	probably benign	Het
Cr2	T	A	1: 195,155,905	K1084*	probably null	Het
Ddx28	A	G	8: 106,010,682	L248P	probably benign	Het
Depdc5	A	G	5: 32,917,942	E488G	probably benign	Het
Dld	T	C	12: 31,334,746	T305A	probably benign	Het
Dok5	T	A	2: 170,841,453	F211L	probably damaging	Het
Duox2	T	C	2: 122,287,051	D934G	probably benign	Het
Eif3a	G	A	19: 60,766,798	T982I	unknown	Het
Erbb2	G	T	11: 98,435,335	R979L	probably benign	Het
Espl1	G	T	15: 102,298,529	V143L	possibly damaging	Het
Fanci	T	C	7: 79,430,488	L598P	probably damaging	Het
Fat2	T	A	11: 55,256,647	E3923V	probably damaging	Het
Fhod3	A	T	18: 24,770,493	K95*	probably null	Het
Gm16286	T	C	18: 80,211,946	S152P	probably benign	Het
Gm7534	C	G	4: 134,200,299	C381S	probably damaging	Het
Gm7534	T	A	4: 134,202,119	T292S	possibly damaging	Het
Gpr108	G	T	17: 57,236,217	T484K	probably damaging	Het
Hao1	T	A	2: 134,498,318	N351I	possibly damaging	Het
Hepacam	A	T	9: 37,383,893	N308I	possibly damaging	Het
Herc2	T	C	7: 56,148,823		probably null	Het
Hltf	T	C	3: 20,076,521	I301T	probably benign	Het
Igsf10	A	T	3: 59,319,093	N2386K	probably damaging	Het
Ikbke	G	T	1: 131,259,200	T585K	probably benign	Het
Iqgap3	A	G	3: 88,113,980	T448A	possibly damaging	Het
Kl	T	C	5: 150,980,985	S401P	possibly damaging	Het
Lama4	T	C	10: 39,065,619	V684A	probably benign	Het
Lgals8	A	T	13: 12,454,943	F45Y	probably damaging	Het
Lgalsl	G	A	11: 20,826,491	R134C	probably benign	Het
Lmcd1	T	C	6: 112,329,914	V349A	probably benign	Het
Lrp1b	T	A	2: 41,728,706	N119Y	possibly damaging	Het
Lrrc73	T	A	17: 46,255,695	I157N	probably damaging	Het
Map3k8	A	G	18: 4,334,766	Y293H	probably damaging	Het
Mybphl	A	T	3: 108,375,084		probably null	Het
Ndrg1	A	G	15: 66,931,081	M140T	possibly damaging	Het
Olfr138	T	A	17: 38,275,106	C112S	possibly damaging	Het
Olfr885	A	G	9: 38,061,500	Y60C	probably damaging	Het
Pbx2	T	C	17: 34,593,977	S76P	possibly damaging	Het
Plcl2	T	A	17: 50,606,798	S278R	probably benign	Het
Polr3d	A	T	14: 70,439,475	L393*	probably null	Het
Prmt6	T	C	3: 110,250,367	Q202R	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sag	T	A	1: 87,831,940	I300N	probably damaging	Het
Sap25	T	A	5: 137,641,918		probably null	Het
Scarb2	A	G	5: 92,460,836	L177P	probably damaging	Het
Sh3pxd2b	A	T	11: 32,422,203	N457Y	possibly damaging	Het
Siae	T	A	9: 37,631,606		probably null	Het
Slc36a1	T	C	11: 55,228,324	L375P	probably damaging	Het
Smg8	A	G	11: 87,085,768	V329A	probably damaging	Het
Tas2r113	A	T	6: 132,893,732	Y241F	probably damaging	Het
Tm9sf3	T	G	19: 41,256,229	S70R	probably benign	Het
Tmem144	C	T	3: 79,825,287	S228N	probably damaging	Het
Tmem45a	C	A	16: 56,822,338	V157F	possibly damaging	Het
Tpbg	G	T	9: 85,844,376	V133L	probably damaging	Het
Trpv3	G	A	11: 73,295,383	V667I	possibly damaging	Het
Ube2c	T	C	2: 164,771,321	F53S	probably damaging	Het
Vmn1r78	T	A	7: 12,153,323	V287D	probably damaging	Het

Other mutations in Vmn2r114

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Vmn2r114	APN	17	23291665	missense	probably damaging	1.00
IGL00990:Vmn2r114	APN	17	23290965	missense	probably benign
IGL00990:Vmn2r114	APN	17	23290983	missense	probably benign	0.23
IGL00990:Vmn2r114	APN	17	23291238	missense	probably damaging	1.00
IGL01838:Vmn2r114	APN	17	23296982	missense	probably benign	0.44
IGL01990:Vmn2r114	APN	17	23310381	missense	probably benign	0.22
IGL01994:Vmn2r114	APN	17	23310477	missense	probably damaging	1.00
IGL02153:Vmn2r114	APN	17	23291808	missense	probably benign	0.01
IGL02453:Vmn2r114	APN	17	23311134	missense	probably benign	0.00
IGL02621:Vmn2r114	APN	17	23310520	missense	probably damaging	0.98
IGL02938:Vmn2r114	APN	17	23291289	missense	probably benign	0.10
IGL03130:Vmn2r114	APN	17	23296996	splice site	probably benign
IGL03325:Vmn2r114	APN	17	23291678	missense	probably damaging	1.00
BB004:Vmn2r114	UTSW	17	23291645	missense	probably damaging	1.00
R0109:Vmn2r114	UTSW	17	23310575	nonsense	probably null
R0164:Vmn2r114	UTSW	17	23309826	critical splice donor site	probably null
R0310:Vmn2r114	UTSW	17	23290943	missense	probably benign	0.23
R0583:Vmn2r114	UTSW	17	23290932	makesense	probably null
R0677:Vmn2r114	UTSW	17	23310594	missense	probably damaging	1.00
R1127:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1147:Vmn2r114	UTSW	17	23311063	missense	probably benign	0.00
R1147:Vmn2r114	UTSW	17	23311063	missense	probably benign	0.00
R1157:Vmn2r114	UTSW	17	23310340	missense	possibly damaging	0.60
R1323:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1347:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1435:Vmn2r114	UTSW	17	23290932	makesense	probably null
R1437:Vmn2r114	UTSW	17	23291211	missense	probably damaging	1.00
R1585:Vmn2r114	UTSW	17	23291701	missense	probably damaging	0.98
R1641:Vmn2r114	UTSW	17	23296988	missense	probably benign	0.00
R1954:Vmn2r114	UTSW	17	23311112	missense	probably benign	0.32
R2081:Vmn2r114	UTSW	17	23291109	missense	possibly damaging	0.91
R2103:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2113:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2134:Vmn2r114	UTSW	17	23291763	missense	probably damaging	1.00
R2149:Vmn2r114	UTSW	17	23290932	makesense	probably null
R2424:Vmn2r114	UTSW	17	23296868	missense	possibly damaging	0.90
R2847:Vmn2r114	UTSW	17	23290974	missense	probably benign	0.00
R2848:Vmn2r114	UTSW	17	23290974	missense	probably benign	0.00
R2893:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3017:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3018:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3019:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3020:Vmn2r114	UTSW	17	23290932	makesense	probably null
R3021:Vmn2r114	UTSW	17	23290932	makesense	probably null
R4628:Vmn2r114	UTSW	17	23290932	makesense	probably null
R4668:Vmn2r114	UTSW	17	23310473	missense	possibly damaging	0.83
R4840:Vmn2r114	UTSW	17	23291379	missense	probably damaging	0.97
R4841:Vmn2r114	UTSW	17	23310362	missense	probably benign	0.04
R4842:Vmn2r114	UTSW	17	23310362	missense	probably benign	0.04
R4856:Vmn2r114	UTSW	17	23308034	missense	probably benign	0.11
R4886:Vmn2r114	UTSW	17	23308034	missense	probably benign	0.11
R4992:Vmn2r114	UTSW	17	23291791	missense	probably benign	0.03
R5182:Vmn2r114	UTSW	17	23291658	missense	probably damaging	0.96
R5223:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5405:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5449:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5615:Vmn2r114	UTSW	17	23290932	makesense	probably null
R5834:Vmn2r114	UTSW	17	23310625	missense	possibly damaging	0.90
R6150:Vmn2r114	UTSW	17	23291295	missense	probably benign	0.03
R6277:Vmn2r114	UTSW	17	23290980	missense	possibly damaging	0.93
R6403:Vmn2r114	UTSW	17	23309965	missense	probably damaging	0.99
R6589:Vmn2r114	UTSW	17	23291668	missense	probably damaging	1.00
R6613:Vmn2r114	UTSW	17	23310246	missense	possibly damaging	0.82
R6747:Vmn2r114	UTSW	17	23309876	missense	probably benign	0.00
R6837:Vmn2r114	UTSW	17	23310202	missense	probably benign	0.10
R6911:Vmn2r114	UTSW	17	23291130	missense	probably damaging	0.98
R6950:Vmn2r114	UTSW	17	23310163	missense	probably benign	0.03
R7276:Vmn2r114	UTSW	17	23290960	missense	probably damaging	0.97
R7482:Vmn2r114	UTSW	17	23291494	missense	probably damaging	1.00
R7514:Vmn2r114	UTSW	17	23308061	missense	probably null	0.96
R7523:Vmn2r114	UTSW	17	23310637	missense	probably benign	0.01
R7563:Vmn2r114	UTSW	17	23291026	missense	probably benign	0.01
R7585:Vmn2r114	UTSW	17	23291265	missense	probably damaging	1.00
R7593:Vmn2r114	UTSW	17	23291843	nonsense	probably null
R7611:Vmn2r114	UTSW	17	23296970	missense	probably damaging	0.97
R7641:Vmn2r114	UTSW	17	23308203	missense	possibly damaging	0.53
R7651:Vmn2r114	UTSW	17	23291012	nonsense	probably null
R7970:Vmn2r114	UTSW	17	23311212	missense	probably benign	0.00
R8737:Vmn2r114	UTSW	17	23310168	missense	probably benign	0.36
R8802:Vmn2r114	UTSW	17	23309862	missense	possibly damaging	0.65
R8847:Vmn2r114	UTSW	17	23310012	missense	probably damaging	1.00
R8991:Vmn2r114	UTSW	17	23310312	missense	probably damaging	1.00
R9138:Vmn2r114	UTSW	17	23291604	missense	probably damaging	1.00
R9173:Vmn2r114	UTSW	17	23291553	missense	probably damaging	0.99
R9175:Vmn2r114	UTSW	17	23308238	missense	probably damaging	1.00
R9657:Vmn2r114	UTSW	17	23291716	missense	probably damaging	1.00
R9670:Vmn2r114	UTSW	17	23312124	missense
X0065:Vmn2r114	UTSW	17	23310957	missense	probably benign	0.34
Z1088:Vmn2r114	UTSW	17	23290932	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- GATCCAGGGCTATTGACATGGCTAAAA -3'
(R):5'- CGGTTGGGGACAGAGTGAATATGAAC -3'

Sequencing Primer
(F):5'- GGCATGAAACAGGTTCTGATATG -3'
(R):5'- TGAATATGAACCAAAGAGACAAACTG -3'

Posted On

2014-05-23