Mutagenetix > Incidental Mutation

Incidental Mutation 'R1748:Alk'

194164

Institutional Source

Beutler Lab

Gene Symbol

Alk

Ensembl Gene

ENSMUSG00000055471

Gene Name

anaplastic lymphoma kinase

Synonyms

CD246, Tcrz

MMRRC Submission

039780-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.173) question?

Stock #

R1748 (G1)

Quality Score

173

Status

Not validated

Chromosome

Chromosomal Location

71869442-72603709 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 72603421 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 97 (C97G)

Ref Sequence

ENSEMBL: ENSMUSP00000083840 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000086639]

AlphaFold

P97793

Predicted Effect

probably benign
Transcript: ENSMUST00000086639
AA Change: C97G

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000083840
Gene: ENSMUSG00000055471
AA Change: C97G

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
low complexity region	99	109	N/A	INTRINSIC
low complexity region	230	242	N/A	INTRINSIC
Pfam:MAM	270	431	5.6e-10	PFAM
LDLa	441	477	5.59e-3	SMART
Pfam:MAM	484	640	5.6e-22	PFAM
Pfam:Gly_rich	730	996	8.6e-19	PFAM
low complexity region	1037	1057	N/A	INTRINSIC
TyrKc	1120	1387	2.76e-140	SMART
low complexity region	1440	1480	N/A	INTRINSIC
low complexity region	1551	1570	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a null allele show increased ethanol consumption and increased sedation in response to ethanol. Male mice homozygous for a different null allele show delayed puberty, hypogonadotropic hypogonadism, reduced serum testosterone levels, and altered seminiferous tubule morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc5	G	T	16: 20,333,588	Q1403K	probably benign	Het
Adamts12	G	A	15: 11,241,462	M373I	probably damaging	Het
Agrp	G	T	8: 105,566,835	T106K	probably damaging	Het
Aire	T	C	10: 78,043,480	H15R	probably damaging	Het
Aldh3b2	T	C	19: 3,977,572	F38L	probably damaging	Het
Ano8	T	C	8: 71,478,958		probably benign	Het
Anpep	C	T	7: 79,838,256	E518K	probably benign	Het
Arsk	T	A	13: 76,062,410	H506L	probably benign	Het
Asgr2	G	T	11: 70,096,832	R52L	probably damaging	Het
Atp2a1	A	G	7: 126,459,608	I145T	possibly damaging	Het
Atrnl1	A	G	19: 57,714,702	T1051A	probably damaging	Het
Cacna1e	A	T	1: 154,486,569	V424D	possibly damaging	Het
Capn3	T	C	2: 120,497,013	V574A	probably benign	Het
Capzb	C	A	4: 139,257,368	D67E	probably damaging	Het
Ccdc68	A	T	18: 69,955,991	T202S	probably benign	Het
Ccser2	T	C	14: 36,896,313	K123R	probably damaging	Het
Ccser2	T	A	14: 36,896,314	K123*	probably null	Het
Ces2h	T	C	8: 105,017,841	I316T	probably benign	Het
Chd3	T	G	11: 69,364,697	K122Q	possibly damaging	Het
Col12a1	T	C	9: 79,672,997	T1533A	probably benign	Het
Cr2	T	A	1: 195,155,905	K1084*	probably null	Het
Ddx28	A	G	8: 106,010,682	L248P	probably benign	Het
Depdc5	A	G	5: 32,917,942	E488G	probably benign	Het
Dld	T	C	12: 31,334,746	T305A	probably benign	Het
Dok5	T	A	2: 170,841,453	F211L	probably damaging	Het
Duox2	T	C	2: 122,287,051	D934G	probably benign	Het
Eif3a	G	A	19: 60,766,798	T982I	unknown	Het
Erbb2	G	T	11: 98,435,335	R979L	probably benign	Het
Espl1	G	T	15: 102,298,529	V143L	possibly damaging	Het
Fanci	T	C	7: 79,430,488	L598P	probably damaging	Het
Fat2	T	A	11: 55,256,647	E3923V	probably damaging	Het
Fhod3	A	T	18: 24,770,493	K95*	probably null	Het
Gm16286	T	C	18: 80,211,946	S152P	probably benign	Het
Gm7534	C	G	4: 134,200,299	C381S	probably damaging	Het
Gm7534	T	A	4: 134,202,119	T292S	possibly damaging	Het
Gpr108	G	T	17: 57,236,217	T484K	probably damaging	Het
Hao1	T	A	2: 134,498,318	N351I	possibly damaging	Het
Hepacam	A	T	9: 37,383,893	N308I	possibly damaging	Het
Herc2	T	C	7: 56,148,823		probably null	Het
Hltf	T	C	3: 20,076,521	I301T	probably benign	Het
Igsf10	A	T	3: 59,319,093	N2386K	probably damaging	Het
Ikbke	G	T	1: 131,259,200	T585K	probably benign	Het
Iqgap3	A	G	3: 88,113,980	T448A	possibly damaging	Het
Kl	T	C	5: 150,980,985	S401P	possibly damaging	Het
Lama4	T	C	10: 39,065,619	V684A	probably benign	Het
Lgals8	A	T	13: 12,454,943	F45Y	probably damaging	Het
Lgalsl	G	A	11: 20,826,491	R134C	probably benign	Het
Lmcd1	T	C	6: 112,329,914	V349A	probably benign	Het
Lrp1b	T	A	2: 41,728,706	N119Y	possibly damaging	Het
Lrrc73	T	A	17: 46,255,695	I157N	probably damaging	Het
Map3k8	A	G	18: 4,334,766	Y293H	probably damaging	Het
Mybphl	A	T	3: 108,375,084		probably null	Het
Ndrg1	A	G	15: 66,931,081	M140T	possibly damaging	Het
Olfr138	T	A	17: 38,275,106	C112S	possibly damaging	Het
Olfr885	A	G	9: 38,061,500	Y60C	probably damaging	Het
Pbx2	T	C	17: 34,593,977	S76P	possibly damaging	Het
Plcl2	T	A	17: 50,606,798	S278R	probably benign	Het
Polr3d	A	T	14: 70,439,475	L393*	probably null	Het
Prmt6	T	C	3: 110,250,367	Q202R	probably benign	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Sag	T	A	1: 87,831,940	I300N	probably damaging	Het
Sap25	T	A	5: 137,641,918		probably null	Het
Scarb2	A	G	5: 92,460,836	L177P	probably damaging	Het
Sh3pxd2b	A	T	11: 32,422,203	N457Y	possibly damaging	Het
Siae	T	A	9: 37,631,606		probably null	Het
Slc36a1	T	C	11: 55,228,324	L375P	probably damaging	Het
Smg8	A	G	11: 87,085,768	V329A	probably damaging	Het
Tas2r113	A	T	6: 132,893,732	Y241F	probably damaging	Het
Tm9sf3	T	G	19: 41,256,229	S70R	probably benign	Het
Tmem144	C	T	3: 79,825,287	S228N	probably damaging	Het
Tmem45a	C	A	16: 56,822,338	V157F	possibly damaging	Het
Tpbg	G	T	9: 85,844,376	V133L	probably damaging	Het
Trpv3	G	A	11: 73,295,383	V667I	possibly damaging	Het
Ube2c	T	C	2: 164,771,321	F53S	probably damaging	Het
Vmn1r78	T	A	7: 12,153,323	V287D	probably damaging	Het
Vmn2r114	T	A	17: 23,308,061	D499V	probably benign	Het

Other mutations in Alk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Alk	APN	17	71895748	missense	probably damaging	1.00
IGL00796:Alk	APN	17	71905142	missense	possibly damaging	0.88
IGL01096:Alk	APN	17	71921896	missense	possibly damaging	0.87
IGL01367:Alk	APN	17	71900786	missense	probably damaging	1.00
IGL01402:Alk	APN	17	71874178	missense	probably damaging	1.00
IGL01652:Alk	APN	17	72603531	missense	probably damaging	1.00
IGL01717:Alk	APN	17	72603382	missense	probably benign
IGL02301:Alk	APN	17	71874176	missense	probably damaging	0.99
IGL02403:Alk	APN	17	71901393	missense	probably damaging	1.00
IGL02452:Alk	APN	17	71902625	nonsense	probably null
IGL02724:Alk	APN	17	71985460	missense	probably benign	0.00
IGL02826:Alk	APN	17	71869536	missense	probably damaging	1.00
IGL02863:Alk	APN	17	71897835	missense	probably damaging	1.00
IGL02994:Alk	APN	17	71949820	missense	probably benign	0.00
IGL03329:Alk	APN	17	71899164	splice site	probably benign
PIT4382001:Alk	UTSW	17	71949921	missense	probably benign
R0157:Alk	UTSW	17	71949845	missense	probably benign	0.00
R0211:Alk	UTSW	17	72603516	missense	probably damaging	1.00
R0257:Alk	UTSW	17	72603495	missense	probably damaging	1.00
R0269:Alk	UTSW	17	72603583	missense	probably damaging	1.00
R0395:Alk	UTSW	17	72603531	missense	probably damaging	0.99
R0414:Alk	UTSW	17	71899286	splice site	probably benign
R0466:Alk	UTSW	17	71905157	missense	possibly damaging	0.51
R0526:Alk	UTSW	17	71869753	missense	probably damaging	1.00
R0617:Alk	UTSW	17	72603583	missense	probably damaging	1.00
R0781:Alk	UTSW	17	71984745	splice site	probably benign
R0830:Alk	UTSW	17	72603200	missense	probably benign	0.01
R0835:Alk	UTSW	17	71869842	missense	probably damaging	0.97
R0894:Alk	UTSW	17	71895935	missense	probably damaging	1.00
R1110:Alk	UTSW	17	71984745	splice site	probably benign
R1170:Alk	UTSW	17	71900734	missense	probably damaging	1.00
R1573:Alk	UTSW	17	72603118	missense	possibly damaging	0.69
R1667:Alk	UTSW	17	71911567	missense	probably damaging	1.00
R1767:Alk	UTSW	17	71900698	missense	possibly damaging	0.73
R1836:Alk	UTSW	17	71891037	missense	probably damaging	1.00
R1861:Alk	UTSW	17	71874938	splice site	probably benign
R2905:Alk	UTSW	17	71985494	missense	probably benign	0.40
R2925:Alk	UTSW	17	72603207	missense	probably benign
R3727:Alk	UTSW	17	71901400	splice site	probably benign
R3747:Alk	UTSW	17	71911565	missense	probably damaging	0.99
R3790:Alk	UTSW	17	72603432	missense	possibly damaging	0.95
R3909:Alk	UTSW	17	71897911	missense	probably benign	0.00
R3934:Alk	UTSW	17	72205954	missense	probably damaging	1.00
R3936:Alk	UTSW	17	72205954	missense	probably damaging	1.00
R3972:Alk	UTSW	17	71985447	missense	probably benign	0.16
R4433:Alk	UTSW	17	71899241	nonsense	probably null
R4716:Alk	UTSW	17	72205942	missense	probably damaging	1.00
R4903:Alk	UTSW	17	71869563	missense	probably damaging	1.00
R4921:Alk	UTSW	17	71904315	missense	probably benign	0.30
R4954:Alk	UTSW	17	71902692	nonsense	probably null
R5377:Alk	UTSW	17	71895739	missense	probably damaging	1.00
R5386:Alk	UTSW	17	71875012	missense	probably damaging	1.00
R5551:Alk	UTSW	17	71875033	missense	possibly damaging	0.53
R5704:Alk	UTSW	17	72603120	missense	probably damaging	1.00
R5877:Alk	UTSW	17	71967526	missense	probably damaging	1.00
R5888:Alk	UTSW	17	71874943	missense	probably damaging	1.00
R6013:Alk	UTSW	17	71900737	missense	probably benign	0.15
R6044:Alk	UTSW	17	71992100	missense	probably benign	0.00
R6058:Alk	UTSW	17	71869747	missense	probably benign	0.01
R6126:Alk	UTSW	17	71875042	missense	possibly damaging	0.82
R6286:Alk	UTSW	17	71880847	missense	probably damaging	0.98
R6744:Alk	UTSW	17	72603082	missense	probably benign	0.35
R6989:Alk	UTSW	17	71897952	missense	probably benign	0.00
R7487:Alk	UTSW	17	71949898	missense	probably benign
R7573:Alk	UTSW	17	71900792	missense	probably damaging	1.00
R7838:Alk	UTSW	17	71967554	missense	possibly damaging	0.53
R8055:Alk	UTSW	17	71899257	missense	probably benign	0.19
R8211:Alk	UTSW	17	71869707	missense	probably benign
R8555:Alk	UTSW	17	71921874	missense	probably damaging	1.00
R8676:Alk	UTSW	17	71897941	missense	probably damaging	0.98
R8847:Alk	UTSW	17	71949825	missense	probably benign	0.14
R8885:Alk	UTSW	17	71895763	missense	probably damaging	1.00
R9177:Alk	UTSW	17	71874195	missense	probably damaging	1.00
R9239:Alk	UTSW	17	71949869	missense	probably benign	0.04
R9268:Alk	UTSW	17	71874195	missense	probably damaging	1.00
R9682:Alk	UTSW	17	71875063	missense	possibly damaging	0.95
RF013:Alk	UTSW	17	71895936	missense	probably damaging	1.00
RF018:Alk	UTSW	17	71949813	missense	probably benign	0.09
Z1088:Alk	UTSW	17	72205807	missense	probably damaging	0.96
Z1177:Alk	UTSW	17	72603063	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CAGCCTTCAAGAATCGTCTCCTCG -3'
(R):5'- TTTTGGCAGCAGCCTCGTACTC -3'

Sequencing Primer
(F):5'- GAATCGTCTCCTCGCCCAG -3'
(R):5'- GGAGCTGCAACCGATCAG -3'

Posted On

2014-05-23