Incidental Mutation 'R0035:Map6'
ID 19417
Institutional Source Beutler Lab
Gene Symbol Map6
Ensembl Gene ENSMUSG00000055407
Gene Name microtubule-associated protein 6
Synonyms Mtap6, 2810411E12Rik, F-STOP, STOP
MMRRC Submission 038329-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.107) question?
Stock # R0035 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 7
Chromosomal Location 98916654-98986344 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98966815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 345 (T345I)
Ref Sequence ENSEMBL: ENSMUSP00000146954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068973] [ENSMUST00000107100] [ENSMUST00000122101] [ENSMUST00000127492] [ENSMUST00000207883] [ENSMUST00000208924] [ENSMUST00000208605]
AlphaFold Q7TSJ2
Predicted Effect probably damaging
Transcript: ENSMUST00000068973
AA Change: T548I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000064787
Gene: ENSMUSG00000055407
AA Change: T548I

DomainStartEndE-ValueType
low complexity region 42 57 N/A INTRINSIC
low complexity region 93 117 N/A INTRINSIC
internal_repeat_1 191 306 6.21e-27 PROSPERO
internal_repeat_1 302 398 6.21e-27 PROSPERO
low complexity region 501 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107100
SMART Domains Protein: ENSMUSP00000102717
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
internal_repeat_1 28 103 5.9e-29 PROSPERO
internal_repeat_1 120 195 5.9e-29 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000122101
SMART Domains Protein: ENSMUSP00000113183
Gene: ENSMUSG00000055407

DomainStartEndE-ValueType
Pfam:STOP 1 184 1.2e-18 PFAM
internal_repeat_1 191 306 1.99e-35 PROSPERO
internal_repeat_1 302 398 1.99e-35 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000127492
AA Change: T548I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129058
Predicted Effect probably damaging
Transcript: ENSMUST00000207883
AA Change: T548I

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000208924
AA Change: T345I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably benign
Transcript: ENSMUST00000208605
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209094
Meta Mutation Damage Score 0.1487 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated protein. The encoded protein is a calmodulin-binding and calmodulin-regulated protein that is involved in microtubule stabilization. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are devoid of cold-stable microtubules, and exhibit impaired synaptic plasticity, associated with severe behavioral abnormalities that are specifically ameliorated by long-term administration of neuroleptics. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik T C 7: 81,438,297 (GRCm39) T20A probably benign Het
Aadacl4 A G 4: 144,344,511 (GRCm39) T96A probably damaging Het
Abcb6 A G 1: 75,151,651 (GRCm39) V473A possibly damaging Het
Abo C A 2: 26,733,385 (GRCm39) K273N possibly damaging Het
Acvr1c A G 2: 58,205,791 (GRCm39) probably benign Het
Adcy8 A T 15: 64,571,217 (GRCm39) V1142D probably benign Het
Akna T A 4: 63,300,682 (GRCm39) H591L probably benign Het
Aox1 T C 1: 58,393,581 (GRCm39) V1247A probably benign Het
Ap4b1 T C 3: 103,727,980 (GRCm39) probably benign Het
Armh3 A T 19: 45,879,679 (GRCm39) M558K probably damaging Het
Atm A G 9: 53,424,480 (GRCm39) V607A probably benign Het
Bltp1 T A 3: 37,041,747 (GRCm39) Y2708* probably null Het
Cass4 C T 2: 172,258,412 (GRCm39) P137S probably damaging Het
Cfap53 A G 18: 74,433,278 (GRCm39) E121G probably damaging Het
Chmp6 T C 11: 119,807,508 (GRCm39) V31A probably damaging Het
Clec4a3 T A 6: 122,944,508 (GRCm39) Y185N probably damaging Het
Clic5 A G 17: 44,586,200 (GRCm39) T230A probably damaging Het
Clspn G T 4: 126,458,796 (GRCm39) probably null Het
Cntn1 T A 15: 92,129,969 (GRCm39) probably benign Het
Col4a3 G A 1: 82,650,474 (GRCm39) G577R unknown Het
Defa21 T A 8: 21,515,784 (GRCm39) probably null Het
Deup1 T C 9: 15,511,117 (GRCm39) R221G possibly damaging Het
Dnah8 A T 17: 30,902,595 (GRCm39) probably benign Het
Dnase1l2 A G 17: 24,660,049 (GRCm39) V273A probably damaging Het
Gm5134 T A 10: 75,829,698 (GRCm39) F328Y probably benign Het
Golph3 A T 15: 12,339,776 (GRCm39) E96D probably damaging Het
Hspd1 A G 1: 55,122,942 (GRCm39) V151A probably benign Het
Htr1f A C 16: 64,746,860 (GRCm39) I144S probably damaging Het
Il23r A G 6: 67,450,772 (GRCm39) probably benign Het
Il25 A G 14: 55,170,553 (GRCm39) E42G probably damaging Het
Il36b A T 2: 24,049,890 (GRCm39) H167L probably benign Het
Klrb1-ps1 C T 6: 129,106,306 (GRCm39) A149V possibly damaging Het
Kmt2e T A 5: 23,690,619 (GRCm39) probably benign Het
Ktn1 A G 14: 47,967,836 (GRCm39) N1167D probably benign Het
Lama4 T A 10: 38,948,734 (GRCm39) D832E probably benign Het
Map1b A G 13: 99,571,846 (GRCm39) S292P probably damaging Het
Mark2 A T 19: 7,262,017 (GRCm39) probably benign Het
Me3 C A 7: 89,500,967 (GRCm39) H559Q probably benign Het
Myo1b A G 1: 51,817,541 (GRCm39) F574L probably damaging Het
Nos2 T C 11: 78,836,553 (GRCm39) S431P probably damaging Het
Nr1h5 T A 3: 102,856,889 (GRCm39) K208* probably null Het
Nup214 T C 2: 31,880,379 (GRCm39) probably null Het
Obp2b T C 2: 25,628,645 (GRCm39) L133P probably damaging Het
Or14a259 T C 7: 86,013,395 (GRCm39) D50G possibly damaging Het
Or5k1 A T 16: 58,617,485 (GRCm39) C241* probably null Het
Osbp2 C T 11: 3,667,997 (GRCm39) probably benign Het
Ptafr C A 4: 132,306,864 (GRCm39) L85I probably benign Het
Ptprk T A 10: 28,139,504 (GRCm39) Y76* probably null Het
Rad50 A G 11: 53,545,854 (GRCm39) probably benign Het
Rasef G T 4: 73,681,091 (GRCm39) probably benign Het
Slitrk6 A T 14: 110,987,364 (GRCm39) L781H probably damaging Het
Tbc1d1 T A 5: 64,414,080 (GRCm39) I18N probably damaging Het
Tbc1d17 T C 7: 44,490,832 (GRCm39) N587D probably benign Het
Trank1 A T 9: 111,195,844 (GRCm39) K1289N probably benign Het
Tspyl3 A G 2: 153,066,240 (GRCm39) S333P probably damaging Het
Ush2a G A 1: 188,089,085 (GRCm39) V347I probably benign Het
Usp17le G T 7: 104,418,269 (GRCm39) S291* probably null Het
Usp24 T A 4: 106,225,224 (GRCm39) S619T probably benign Het
Vmn2r10 T C 5: 109,145,467 (GRCm39) probably benign Het
Vmn2r78 A G 7: 86,569,413 (GRCm39) E102G probably benign Het
Vwa3b G A 1: 37,204,770 (GRCm39) V85I possibly damaging Het
Wwp1 A C 4: 19,631,116 (GRCm39) I639R probably damaging Het
Xpo5 A G 17: 46,551,101 (GRCm39) T1001A probably benign Het
Zc3h12c A T 9: 52,055,047 (GRCm39) M235K probably benign Het
Zfp619 G A 7: 39,186,706 (GRCm39) G912D probably damaging Het
Other mutations in Map6
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0035:Map6 UTSW 7 98,966,815 (GRCm39) missense probably damaging 1.00
R0118:Map6 UTSW 7 98,966,824 (GRCm39) missense possibly damaging 0.53
R0125:Map6 UTSW 7 98,985,187 (GRCm39) splice site probably null
R0244:Map6 UTSW 7 98,986,043 (GRCm39) missense probably benign 0.00
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0973:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R0974:Map6 UTSW 7 98,985,950 (GRCm39) missense possibly damaging 0.78
R1455:Map6 UTSW 7 98,917,421 (GRCm39) missense probably damaging 1.00
R1678:Map6 UTSW 7 98,917,305 (GRCm39) missense probably damaging 1.00
R1696:Map6 UTSW 7 98,966,664 (GRCm39) splice site probably null
R1866:Map6 UTSW 7 98,965,083 (GRCm39) missense probably damaging 1.00
R2061:Map6 UTSW 7 98,966,679 (GRCm39) missense probably damaging 1.00
R3236:Map6 UTSW 7 98,986,031 (GRCm39) missense probably damaging 1.00
R3625:Map6 UTSW 7 98,918,402 (GRCm39) missense possibly damaging 0.60
R4044:Map6 UTSW 7 98,917,256 (GRCm39) missense probably damaging 1.00
R4570:Map6 UTSW 7 98,985,763 (GRCm39) missense possibly damaging 0.49
R5056:Map6 UTSW 7 98,985,859 (GRCm39) missense probably benign 0.05
R5065:Map6 UTSW 7 98,985,917 (GRCm39) missense probably benign 0.02
R5656:Map6 UTSW 7 98,985,505 (GRCm39) missense probably damaging 1.00
R6101:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6105:Map6 UTSW 7 98,917,314 (GRCm39) missense probably damaging 1.00
R6302:Map6 UTSW 7 98,985,314 (GRCm39) missense probably damaging 0.99
R6450:Map6 UTSW 7 98,917,245 (GRCm39) missense probably damaging 1.00
R6915:Map6 UTSW 7 98,917,454 (GRCm39) missense probably damaging 1.00
R7205:Map6 UTSW 7 98,918,257 (GRCm39) missense probably benign 0.00
R7223:Map6 UTSW 7 98,917,232 (GRCm39) missense probably damaging 1.00
R7293:Map6 UTSW 7 98,985,740 (GRCm39) missense possibly damaging 0.49
R7481:Map6 UTSW 7 98,918,345 (GRCm39) missense possibly damaging 0.57
R7489:Map6 UTSW 7 98,917,268 (GRCm39) missense probably damaging 1.00
R7691:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7693:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R7695:Map6 UTSW 7 98,985,499 (GRCm39) missense possibly damaging 0.95
R8341:Map6 UTSW 7 98,917,647 (GRCm39) missense possibly damaging 0.75
R8865:Map6 UTSW 7 98,918,192 (GRCm39) missense probably benign 0.37
R8953:Map6 UTSW 7 98,965,078 (GRCm39) missense probably damaging 1.00
R9108:Map6 UTSW 7 98,986,103 (GRCm39) missense probably damaging 1.00
R9173:Map6 UTSW 7 98,917,935 (GRCm39) missense probably damaging 1.00
R9613:Map6 UTSW 7 98,918,384 (GRCm39) missense possibly damaging 0.90
R9654:Map6 UTSW 7 98,986,166 (GRCm39) missense probably damaging 1.00
Z1176:Map6 UTSW 7 98,966,867 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTGCTCACCAAGGAGAAATG -3'
(R):5'- GTAAGAGTCGGTGGCCTCAGAAAC -3'

Sequencing Primer
(F):5'- GGTGCCTATACACTGTGAGATCC -3'
(R):5'- GGTGGCCTCAGAAACATAATTTCTC -3'
Posted On 2013-04-11