Incidental Mutation 'R1749:Sp100'
ID194176
Institutional Source Beutler Lab
Gene Symbol Sp100
Ensembl Gene ENSMUSG00000026222
Gene Namenuclear antigen Sp100
Synonyms
MMRRC Submission 039781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R1749 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location85649988-85709998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85699636 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 417 (T417P)
Ref Sequence ENSEMBL: ENSMUSP00000118481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066427] [ENSMUST00000132641] [ENSMUST00000145440] [ENSMUST00000147552] [ENSMUST00000150967] [ENSMUST00000153574] [ENSMUST00000155094]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066427
AA Change: T417P

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000066399
Gene: ENSMUSG00000026222
AA Change: T417P

DomainStartEndE-ValueType
Pfam:Sp100 21 119 3.4e-40 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
BROMO 473 573 1.16e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000132641
AA Change: T50P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000120267
Gene: ENSMUSG00000026222
AA Change: T50P

DomainStartEndE-ValueType
SAND 19 92 8.85e-38 SMART
low complexity region 101 114 N/A INTRINSIC
PHD 117 159 5.97e-3 SMART
BROMO 184 284 5.49e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134283
Predicted Effect probably benign
Transcript: ENSMUST00000141709
SMART Domains Protein: ENSMUSP00000119301
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
PHD 36 78 5.97e-3 SMART
Blast:BROMO 103 136 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000145440
SMART Domains Protein: ENSMUSP00000120604
Gene: ENSMUSG00000026222

DomainStartEndE-ValueType
Pfam:Sp100 19 122 3.7e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147552
AA Change: T399P

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116942
Gene: ENSMUSG00000026222
AA Change: T399P

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.5e-46 PFAM
low complexity region 305 319 N/A INTRINSIC
low complexity region 349 359 N/A INTRINSIC
SAND 368 441 8.85e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000150967
AA Change: T374P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122899
Gene: ENSMUSG00000026222
AA Change: T374P

DomainStartEndE-ValueType
Pfam:Sp100 19 122 2.1e-46 PFAM
low complexity region 324 334 N/A INTRINSIC
SAND 343 416 8.85e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000153574
AA Change: T392P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122670
Gene: ENSMUSG00000026222
AA Change: T392P

DomainStartEndE-ValueType
Pfam:Sp100 19 122 9.2e-47 PFAM
low complexity region 342 352 N/A INTRINSIC
SAND 361 434 8.85e-38 SMART
Blast:BROMO 453 476 9e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000155094
AA Change: T417P

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118481
Gene: ENSMUSG00000026222
AA Change: T417P

DomainStartEndE-ValueType
Pfam:Sp100 19 122 1.6e-46 PFAM
low complexity region 320 335 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
SAND 386 459 8.85e-38 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A T 3: 152,472,920 M486K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Aspn A T 13: 49,551,785 D41V probably benign Het
Atp8a2 C A 14: 59,860,174 E802* probably null Het
Barhl2 T C 5: 106,457,706 S46G unknown Het
Cacna1e A G 1: 154,444,000 V1318A probably damaging Het
Ccdc69 T C 11: 55,051,153 R176G probably null Het
Cdan1 T C 2: 120,729,799 N321S probably damaging Het
Cep85l T C 10: 53,278,154 D681G probably damaging Het
Cntrob A T 11: 69,322,874 V30E probably damaging Het
Csmd3 C T 15: 47,585,660 G3646E probably damaging Het
Cx3cl1 A G 8: 94,780,161 probably null Het
Dab1 A T 4: 104,328,298 probably benign Het
Dennd2c T C 3: 103,132,036 S167P possibly damaging Het
Dock2 A G 11: 34,232,767 probably null Het
Dok3 GCC GC 13: 55,524,355 probably null Het
Ebf1 A T 11: 44,908,008 I287L possibly damaging Het
Eci1 G A 17: 24,426,747 probably null Het
Emb T A 13: 117,249,706 I133N possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbn2 T C 18: 58,050,276 D1779G probably benign Het
Fgfr4 T A 13: 55,167,792 probably null Het
Flt1 G A 5: 147,655,119 T511M probably benign Het
Gys1 T C 7: 45,440,032 L205P probably damaging Het
Hepacam2 A G 6: 3,483,379 V134A probably damaging Het
Htr3a A G 9: 48,900,933 V291A probably damaging Het
Ip6k3 T A 17: 27,145,079 T332S probably benign Het
Klra6 A T 6: 130,018,952 F148I probably damaging Het
Kntc1 T C 5: 123,789,099 S1206P probably benign Het
Mbnl2 T A 14: 120,389,050 C231S probably damaging Het
Mdn1 A T 4: 32,773,952 D5521V probably damaging Het
Mylip G A 13: 45,404,470 V52M possibly damaging Het
Naip6 A G 13: 100,308,255 S232P probably benign Het
Ndc80 T C 17: 71,501,555 K504R probably benign Het
Nf2 T C 11: 4,803,694 N220S possibly damaging Het
Nfasc T A 1: 132,611,632 I393F probably damaging Het
Olfr102 T C 17: 37,314,061 T108A probably benign Het
Pabpc1 T C 15: 36,608,340 Y56C probably damaging Het
Pcca A G 14: 122,701,130 K498R probably damaging Het
Phldb1 A G 9: 44,715,748 S467P probably damaging Het
Ptprn2 T C 12: 116,580,428 S47P probably benign Het
Rtca A T 3: 116,497,644 I229N possibly damaging Het
Sh3rf2 T A 18: 42,153,294 S617R probably damaging Het
Slc14a2 T G 18: 78,147,080 T885P possibly damaging Het
Tat A T 8: 109,996,214 N303Y probably damaging Het
Tet2 A G 3: 133,480,131 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tnks1bp1 A G 2: 85,063,067 S1113G probably benign Het
Tspear G A 10: 77,869,673 E302K probably benign Het
Tulp3 A G 6: 128,337,759 L23P probably damaging Het
Vti1b T C 12: 79,165,033 E42G probably damaging Het
Yeats2 G T 16: 20,186,268 E333* probably null Het
Zfp455 T G 13: 67,207,009 C114G probably damaging Het
Zfp532 G A 18: 65,623,484 V163M possibly damaging Het
Zfp940 A T 7: 29,845,527 C318* probably null Het
Other mutations in Sp100
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Sp100 APN 1 85670020 missense possibly damaging 0.48
IGL01998:Sp100 APN 1 85666929 missense probably benign 0.01
IGL02192:Sp100 APN 1 85708001 missense probably damaging 0.99
IGL02809:Sp100 APN 1 85681124 missense probably damaging 0.99
IGL03274:Sp100 APN 1 85707304 intron probably benign
PIT4458001:Sp100 UTSW 1 85708116 missense probably benign 0.10
R0115:Sp100 UTSW 1 85650131 splice site probably benign
R0599:Sp100 UTSW 1 85681110 missense possibly damaging 0.68
R0620:Sp100 UTSW 1 85659867 splice site probably null
R0693:Sp100 UTSW 1 85667005 critical splice donor site probably null
R0709:Sp100 UTSW 1 85694281 missense probably damaging 0.96
R0744:Sp100 UTSW 1 85699744 missense probably damaging 0.97
R0836:Sp100 UTSW 1 85699744 missense probably damaging 0.97
R1175:Sp100 UTSW 1 85701420 missense possibly damaging 0.83
R1496:Sp100 UTSW 1 85663521 splice site probably benign
R2046:Sp100 UTSW 1 85709065 missense possibly damaging 0.53
R2069:Sp100 UTSW 1 85681142 splice site probably null
R2441:Sp100 UTSW 1 85703489 unclassified probably benign
R3933:Sp100 UTSW 1 85681109 missense probably benign 0.29
R4171:Sp100 UTSW 1 85706841 missense probably benign 0.00
R4762:Sp100 UTSW 1 85701458 makesense probably null
R4863:Sp100 UTSW 1 85705003 missense probably benign 0.03
R5156:Sp100 UTSW 1 85673683 missense probably damaging 1.00
R5273:Sp100 UTSW 1 85709104 missense possibly damaging 0.86
R5635:Sp100 UTSW 1 85682264 intron probably benign
R5810:Sp100 UTSW 1 85665285 missense probably benign 0.12
R5910:Sp100 UTSW 1 85681140 critical splice donor site probably null
R5931:Sp100 UTSW 1 85679083 missense probably damaging 1.00
R7466:Sp100 UTSW 1 85707239 missense possibly damaging 0.93
R7514:Sp100 UTSW 1 85681139 nonsense probably null
R7647:Sp100 UTSW 1 85692043 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GCTCTACCCTGGAGCACAGTAAAAG -3'
(R):5'- CCCAGAATATTGGAAGCTGCCTGTC -3'

Sequencing Primer
(F):5'- ccacagaccaacaaaacacc -3'
(R):5'- TGTCACACAGCAGAAACTTTTCATC -3'
Posted On2014-05-23