Incidental Mutation 'R1749:Ak5'
ID194186
Institutional Source Beutler Lab
Gene Symbol Ak5
Ensembl Gene ENSMUSG00000039058
Gene Nameadenylate kinase 5
Synonyms
MMRRC Submission 039781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R1749 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location152462815-152668360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 152472920 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 486 (M486K)
Ref Sequence ENSEMBL: ENSMUSP00000042785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045262]
Predicted Effect probably damaging
Transcript: ENSMUST00000045262
AA Change: M486K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000042785
Gene: ENSMUSG00000039058
AA Change: M486K

DomainStartEndE-ValueType
Pfam:AAA_17 134 263 1.1e-8 PFAM
Pfam:AAA_18 135 274 3e-10 PFAM
Pfam:ADK 137 294 5.8e-35 PFAM
Pfam:AAA_17 378 525 2.9e-8 PFAM
Pfam:ADK 381 537 1.9e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198552
Predicted Effect unknown
Transcript: ENSMUST00000200062
AA Change: M144K
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the adenylate kinase family, which is involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. This member is related to the UMP/CMP kinase of several species. It is located in the cytosol and expressed exclusively in brain. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Aspn A T 13: 49,551,785 D41V probably benign Het
Atp8a2 C A 14: 59,860,174 E802* probably null Het
Barhl2 T C 5: 106,457,706 S46G unknown Het
Cacna1e A G 1: 154,444,000 V1318A probably damaging Het
Ccdc69 T C 11: 55,051,153 R176G probably null Het
Cdan1 T C 2: 120,729,799 N321S probably damaging Het
Cep85l T C 10: 53,278,154 D681G probably damaging Het
Cntrob A T 11: 69,322,874 V30E probably damaging Het
Csmd3 C T 15: 47,585,660 G3646E probably damaging Het
Cx3cl1 A G 8: 94,780,161 probably null Het
Dab1 A T 4: 104,328,298 probably benign Het
Dennd2c T C 3: 103,132,036 S167P possibly damaging Het
Dock2 A G 11: 34,232,767 probably null Het
Dok3 GCC GC 13: 55,524,355 probably null Het
Ebf1 A T 11: 44,908,008 I287L possibly damaging Het
Eci1 G A 17: 24,426,747 probably null Het
Emb T A 13: 117,249,706 I133N possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbn2 T C 18: 58,050,276 D1779G probably benign Het
Fgfr4 T A 13: 55,167,792 probably null Het
Flt1 G A 5: 147,655,119 T511M probably benign Het
Gys1 T C 7: 45,440,032 L205P probably damaging Het
Hepacam2 A G 6: 3,483,379 V134A probably damaging Het
Htr3a A G 9: 48,900,933 V291A probably damaging Het
Ip6k3 T A 17: 27,145,079 T332S probably benign Het
Klra6 A T 6: 130,018,952 F148I probably damaging Het
Kntc1 T C 5: 123,789,099 S1206P probably benign Het
Mbnl2 T A 14: 120,389,050 C231S probably damaging Het
Mdn1 A T 4: 32,773,952 D5521V probably damaging Het
Mylip G A 13: 45,404,470 V52M possibly damaging Het
Naip6 A G 13: 100,308,255 S232P probably benign Het
Ndc80 T C 17: 71,501,555 K504R probably benign Het
Nf2 T C 11: 4,803,694 N220S possibly damaging Het
Nfasc T A 1: 132,611,632 I393F probably damaging Het
Olfr102 T C 17: 37,314,061 T108A probably benign Het
Pabpc1 T C 15: 36,608,340 Y56C probably damaging Het
Pcca A G 14: 122,701,130 K498R probably damaging Het
Phldb1 A G 9: 44,715,748 S467P probably damaging Het
Ptprn2 T C 12: 116,580,428 S47P probably benign Het
Rtca A T 3: 116,497,644 I229N possibly damaging Het
Sh3rf2 T A 18: 42,153,294 S617R probably damaging Het
Slc14a2 T G 18: 78,147,080 T885P possibly damaging Het
Sp100 A C 1: 85,699,636 T417P possibly damaging Het
Tat A T 8: 109,996,214 N303Y probably damaging Het
Tet2 A G 3: 133,480,131 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tnks1bp1 A G 2: 85,063,067 S1113G probably benign Het
Tspear G A 10: 77,869,673 E302K probably benign Het
Tulp3 A G 6: 128,337,759 L23P probably damaging Het
Vti1b T C 12: 79,165,033 E42G probably damaging Het
Yeats2 G T 16: 20,186,268 E333* probably null Het
Zfp455 T G 13: 67,207,009 C114G probably damaging Het
Zfp532 G A 18: 65,623,484 V163M possibly damaging Het
Zfp940 A T 7: 29,845,527 C318* probably null Het
Other mutations in Ak5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02178:Ak5 APN 3 152526785 missense probably benign 0.28
IGL02237:Ak5 APN 3 152499343 missense probably benign 0.44
IGL02661:Ak5 APN 3 152463956 missense probably benign
IGL03097:Ak5 UTSW 3 152660514 critical splice donor site probably null
R0645:Ak5 UTSW 3 152653615 missense probably damaging 1.00
R1135:Ak5 UTSW 3 152653662 missense probably damaging 1.00
R1346:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1347:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1347:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R1349:Ak5 UTSW 3 152533434 missense probably damaging 1.00
R2059:Ak5 UTSW 3 152660637 missense probably damaging 1.00
R3929:Ak5 UTSW 3 152667807 missense probably damaging 0.98
R4433:Ak5 UTSW 3 152655880 missense probably damaging 1.00
R4909:Ak5 UTSW 3 152655877 missense probably damaging 1.00
R5052:Ak5 UTSW 3 152660567 missense probably benign 0.00
R5097:Ak5 UTSW 3 152481633 missense probably damaging 0.99
R5645:Ak5 UTSW 3 152656033 missense possibly damaging 0.92
R5907:Ak5 UTSW 3 152615952 missense probably damaging 1.00
R6505:Ak5 UTSW 3 152481669 missense probably benign 0.01
R7117:Ak5 UTSW 3 152615856 critical splice donor site probably null
R7397:Ak5 UTSW 3 152478352 missense probably damaging 1.00
R7455:Ak5 UTSW 3 152481572 missense probably damaging 0.99
X0023:Ak5 UTSW 3 152616027 missense probably damaging 1.00
X0024:Ak5 UTSW 3 152653597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTCTCGTAGTAGGTGACGACG -3'
(R):5'- GACAGACTGGCTGCACTAGGAAAC -3'

Sequencing Primer
(F):5'- TGACGACGGGGATGGAC -3'
(R):5'- ctgcactaggaaactttcgac -3'
Posted On2014-05-23