Incidental Mutation 'R0035:Zc3h12c'
ID19420
Institutional Source Beutler Lab
Gene Symbol Zc3h12c
Ensembl Gene ENSMUSG00000035164
Gene Namezinc finger CCCH type containing 12C
SynonymsC230027N18Rik
MMRRC Submission 038329-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0035 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location52111344-52168572 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 52143747 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 235 (M235K)
Ref Sequence ENSEMBL: ENSMUSP00000150821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165519] [ENSMUST00000213645]
Predicted Effect probably benign
Transcript: ENSMUST00000165519
AA Change: M254K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127603
Gene: ENSMUSG00000035164
AA Change: M254K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 53 65 N/A INTRINSIC
low complexity region 106 121 N/A INTRINSIC
Pfam:RNase_Zc3h12a 264 420 1.6e-67 PFAM
low complexity region 644 659 N/A INTRINSIC
low complexity region 746 758 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213645
AA Change: M235K

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 99% (70/71)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik T C 7: 81,788,549 T20A probably benign Het
4932438A13Rik T A 3: 36,987,598 Y2708* probably null Het
9130011E15Rik A T 19: 45,891,240 M558K probably damaging Het
Aadacl4 A G 4: 144,617,941 T96A probably damaging Het
Abcb6 A G 1: 75,175,007 V473A possibly damaging Het
Abo C A 2: 26,843,373 K273N possibly damaging Het
Acvr1c A G 2: 58,315,779 probably benign Het
Adcy8 A T 15: 64,699,368 V1142D probably benign Het
Akna T A 4: 63,382,445 H591L probably benign Het
Aox2 T C 1: 58,354,422 V1247A probably benign Het
Ap4b1 T C 3: 103,820,664 probably benign Het
Atm A G 9: 53,513,180 V607A probably benign Het
Cass4 C T 2: 172,416,492 P137S probably damaging Het
Cfap53 A G 18: 74,300,207 E121G probably damaging Het
Chmp6 T C 11: 119,916,682 V31A probably damaging Het
Clec4a3 T A 6: 122,967,549 Y185N probably damaging Het
Clic5 A G 17: 44,275,313 T230A probably damaging Het
Clspn G T 4: 126,565,003 probably null Het
Cntn1 T A 15: 92,232,088 probably benign Het
Col4a3 G A 1: 82,672,753 G577R unknown Het
Defa21 T A 8: 21,025,768 probably null Het
Deup1 T C 9: 15,599,821 R221G possibly damaging Het
Dnah8 A T 17: 30,683,621 probably benign Het
Dnase1l2 A G 17: 24,441,075 V273A probably damaging Het
Gm5134 T A 10: 75,993,864 F328Y probably benign Het
Golph3 A T 15: 12,339,690 E96D probably damaging Het
Hspd1 A G 1: 55,083,783 V151A probably benign Het
Htr1f A C 16: 64,926,497 I144S probably damaging Het
Il1f8 A T 2: 24,159,878 H167L probably benign Het
Il23r A G 6: 67,473,788 probably benign Het
Il25 A G 14: 54,933,096 E42G probably damaging Het
Klrb1-ps1 C T 6: 129,129,343 A149V possibly damaging Het
Kmt2e T A 5: 23,485,621 probably benign Het
Ktn1 A G 14: 47,730,379 N1167D probably benign Het
Lama4 T A 10: 39,072,738 D832E probably benign Het
Map1b A G 13: 99,435,338 S292P probably damaging Het
Map6 C T 7: 99,317,608 T345I probably damaging Het
Mark2 A T 19: 7,284,652 probably benign Het
Me3 C A 7: 89,851,759 H559Q probably benign Het
Myo1b A G 1: 51,778,382 F574L probably damaging Het
Nos2 T C 11: 78,945,727 S431P probably damaging Het
Nr1h5 T A 3: 102,949,573 K208* probably null Het
Nup214 T C 2: 31,990,367 probably null Het
Obp2b T C 2: 25,738,633 L133P probably damaging Het
Olfr173 A T 16: 58,797,122 C241* probably null Het
Olfr305 T C 7: 86,364,187 D50G possibly damaging Het
Osbp2 C T 11: 3,717,997 probably benign Het
Ptafr C A 4: 132,579,553 L85I probably benign Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Rad50 A G 11: 53,655,027 probably benign Het
Rasef G T 4: 73,762,854 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Tbc1d1 T A 5: 64,256,737 I18N probably damaging Het
Tbc1d17 T C 7: 44,841,408 N587D probably benign Het
Trank1 A T 9: 111,366,776 K1289N probably benign Het
Tspyl3 A G 2: 153,224,320 S333P probably damaging Het
Ush2a G A 1: 188,356,888 V347I probably benign Het
Usp17le G T 7: 104,769,062 S291* probably null Het
Usp24 T A 4: 106,368,027 S619T probably benign Het
Vmn2r10 T C 5: 108,997,601 probably benign Het
Vmn2r78 A G 7: 86,920,205 E102G probably benign Het
Vwa3b G A 1: 37,165,689 V85I possibly damaging Het
Wwp1 A C 4: 19,631,116 I639R probably damaging Het
Xpo5 A G 17: 46,240,175 T1001A probably benign Het
Zfp619 G A 7: 39,537,282 G912D probably damaging Het
Other mutations in Zc3h12c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Zc3h12c APN 9 52116665 missense probably damaging 1.00
IGL01288:Zc3h12c APN 9 52117651 splice site probably benign
IGL01993:Zc3h12c APN 9 52116311 missense probably damaging 1.00
R0035:Zc3h12c UTSW 9 52143747 missense probably benign 0.04
R0131:Zc3h12c UTSW 9 52126623 missense possibly damaging 0.87
R0240:Zc3h12c UTSW 9 52144083 missense possibly damaging 0.77
R0240:Zc3h12c UTSW 9 52144083 missense possibly damaging 0.77
R1762:Zc3h12c UTSW 9 52115781 missense probably benign 0.17
R2101:Zc3h12c UTSW 9 52116421 missense probably benign 0.01
R3052:Zc3h12c UTSW 9 52144056 missense possibly damaging 0.94
R3689:Zc3h12c UTSW 9 52115956 missense probably benign 0.00
R4163:Zc3h12c UTSW 9 52115699 missense probably damaging 1.00
R4230:Zc3h12c UTSW 9 52144428 critical splice acceptor site probably null
R4803:Zc3h12c UTSW 9 52116553 missense probably damaging 1.00
R5008:Zc3h12c UTSW 9 52116700 missense probably benign 0.00
R5153:Zc3h12c UTSW 9 52126647 missense probably damaging 1.00
R5682:Zc3h12c UTSW 9 52126576 missense probably damaging 1.00
R5843:Zc3h12c UTSW 9 52116682 missense probably benign 0.01
R6613:Zc3h12c UTSW 9 52116112 missense possibly damaging 0.65
R7097:Zc3h12c UTSW 9 52115926 missense possibly damaging 0.77
R7460:Zc3h12c UTSW 9 52144102 missense probably benign 0.13
R7867:Zc3h12c UTSW 9 52143948 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCAGACCCTGAGTGTGATACTGAG -3'
(R):5'- CAGGTCCAGCTTGTGCTAAACAAAC -3'

Sequencing Primer
(F):5'- AGCCATCACGATTTAGTCAGAG -3'
(R):5'- AGTGAAGCCGATCAAACAGT -3'
Posted On2013-04-11