Incidental Mutation 'R1749:Cntrob'
ID 194210
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
MMRRC Submission 039781-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R1749 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69213700 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 30 (V30E)
Ref Sequence ENSEMBL: ENSMUSP00000122205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018614] [ENSMUST00000060956] [ENSMUST00000092973] [ENSMUST00000102601] [ENSMUST00000102602] [ENSMUST00000108662] [ENSMUST00000123176]
AlphaFold Q8CB62
Predicted Effect probably benign
Transcript: ENSMUST00000018614
SMART Domains Protein: ENSMUSP00000018614
Gene: ENSMUSG00000018470

DomainStartEndE-ValueType
low complexity region 23 49 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:Aldo_ket_red 92 396 1.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060956
SMART Domains Protein: ENSMUSP00000050153
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 109 2.2e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092973
AA Change: V30E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: V30E

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102601
SMART Domains Protein: ENSMUSP00000099661
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102602
SMART Domains Protein: ENSMUSP00000099662
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108662
SMART Domains Protein: ENSMUSP00000104302
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 127 2.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123176
AA Change: V30E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140555
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A T 3: 152,178,557 (GRCm39) M486K probably damaging Het
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Aspn A T 13: 49,705,261 (GRCm39) D41V probably benign Het
Atp8a2 C A 14: 60,097,623 (GRCm39) E802* probably null Het
Barhl2 T C 5: 106,605,572 (GRCm39) S46G unknown Het
Cacna1e A G 1: 154,319,746 (GRCm39) V1318A probably damaging Het
Ccdc69 T C 11: 54,941,979 (GRCm39) R176G probably null Het
Cdan1 T C 2: 120,560,280 (GRCm39) N321S probably damaging Het
Cep85l T C 10: 53,154,250 (GRCm39) D681G probably damaging Het
Csmd3 C T 15: 47,449,056 (GRCm39) G3646E probably damaging Het
Cx3cl1 A G 8: 95,506,789 (GRCm39) probably null Het
Dab1 A T 4: 104,185,495 (GRCm39) probably benign Het
Dennd2c T C 3: 103,039,352 (GRCm39) S167P possibly damaging Het
Dock2 A G 11: 34,182,767 (GRCm39) probably null Het
Dok3 GCC GC 13: 55,672,168 (GRCm39) probably null Het
Ebf1 A T 11: 44,798,835 (GRCm39) I287L possibly damaging Het
Eci1 G A 17: 24,645,721 (GRCm39) probably null Het
Emb T A 13: 117,386,242 (GRCm39) I133N possibly damaging Het
Fam91a1 A G 15: 58,298,443 (GRCm39) I184V probably benign Het
Fbn2 T C 18: 58,183,348 (GRCm39) D1779G probably benign Het
Fgfr4 T A 13: 55,315,605 (GRCm39) probably null Het
Flt1 G A 5: 147,591,929 (GRCm39) T511M probably benign Het
Gys1 T C 7: 45,089,456 (GRCm39) L205P probably damaging Het
Hepacam2 A G 6: 3,483,379 (GRCm39) V134A probably damaging Het
Htr3a A G 9: 48,812,233 (GRCm39) V291A probably damaging Het
Ip6k3 T A 17: 27,364,053 (GRCm39) T332S probably benign Het
Klra6 A T 6: 129,995,915 (GRCm39) F148I probably damaging Het
Kntc1 T C 5: 123,927,162 (GRCm39) S1206P probably benign Het
Mbnl2 T A 14: 120,626,462 (GRCm39) C231S probably damaging Het
Mdn1 A T 4: 32,773,952 (GRCm39) D5521V probably damaging Het
Mylip G A 13: 45,557,946 (GRCm39) V52M possibly damaging Het
Naip6 A G 13: 100,444,763 (GRCm39) S232P probably benign Het
Ndc80 T C 17: 71,808,550 (GRCm39) K504R probably benign Het
Nf2 T C 11: 4,753,694 (GRCm39) N220S possibly damaging Het
Nfasc T A 1: 132,539,370 (GRCm39) I393F probably damaging Het
Or12d2 T C 17: 37,624,952 (GRCm39) T108A probably benign Het
Pabpc1 T C 15: 36,608,584 (GRCm39) Y56C probably damaging Het
Pcca A G 14: 122,938,542 (GRCm39) K498R probably damaging Het
Phldb1 A G 9: 44,627,045 (GRCm39) S467P probably damaging Het
Ptprn2 T C 12: 116,544,048 (GRCm39) S47P probably benign Het
Rtca A T 3: 116,291,293 (GRCm39) I229N possibly damaging Het
Sh3rf2 T A 18: 42,286,359 (GRCm39) S617R probably damaging Het
Slc14a2 T G 18: 78,190,295 (GRCm39) T885P possibly damaging Het
Sp100 A C 1: 85,627,357 (GRCm39) T417P possibly damaging Het
Tat A T 8: 110,722,846 (GRCm39) N303Y probably damaging Het
Tet2 A G 3: 133,185,892 (GRCm39) probably null Het
Tln2 C T 9: 67,193,796 (GRCm39) A1773T probably benign Het
Tnks1bp1 A G 2: 84,893,411 (GRCm39) S1113G probably benign Het
Tspear G A 10: 77,705,507 (GRCm39) E302K probably benign Het
Tulp3 A G 6: 128,314,722 (GRCm39) L23P probably damaging Het
Vti1b T C 12: 79,211,807 (GRCm39) E42G probably damaging Het
Yeats2 G T 16: 20,005,018 (GRCm39) E333* probably null Het
Zfp455 T G 13: 67,355,073 (GRCm39) C114G probably damaging Het
Zfp532 G A 18: 65,756,555 (GRCm39) V163M possibly damaging Het
Zfp940 A T 7: 29,544,952 (GRCm39) C318* probably null Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R4982:Cntrob UTSW 11 69,202,188 (GRCm39) splice site probably null
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCATGAAAGCCCTGTGTGCTTG -3'
(R):5'- AGTCAGTGGACACTCCTCTAACCAG -3'

Sequencing Primer
(F):5'- GCCCAGGAACCTAATGCTTTC -3'
(R):5'- GCTCATTTGTTGAGGACCCAAAG -3'
Posted On 2014-05-23