Incidental Mutation 'R1749:Cntrob'
ID194210
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Namecentrobin, centrosomal BRCA2 interacting protein
SynonymsLip8, 9830165K03Rik
MMRRC Submission 039781-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R1749 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69299487-69323775 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69322874 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 30 (V30E)
Ref Sequence ENSEMBL: ENSMUSP00000122205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018614] [ENSMUST00000060956] [ENSMUST00000092973] [ENSMUST00000102601] [ENSMUST00000102602] [ENSMUST00000108662] [ENSMUST00000123176]
Predicted Effect probably benign
Transcript: ENSMUST00000018614
SMART Domains Protein: ENSMUSP00000018614
Gene: ENSMUSG00000018470

DomainStartEndE-ValueType
low complexity region 23 49 N/A INTRINSIC
low complexity region 54 65 N/A INTRINSIC
Pfam:Aldo_ket_red 92 396 1.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060956
SMART Domains Protein: ENSMUSP00000050153
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 109 2.2e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092973
AA Change: V30E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: V30E

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102601
SMART Domains Protein: ENSMUSP00000099661
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102602
SMART Domains Protein: ENSMUSP00000099662
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 137 1.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108662
SMART Domains Protein: ENSMUSP00000104302
Gene: ENSMUSG00000049299

DomainStartEndE-ValueType
Pfam:Sybindin 3 127 2.2e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123176
AA Change: V30E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176111
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A T 3: 152,472,920 M486K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Aspn A T 13: 49,551,785 D41V probably benign Het
Atp8a2 C A 14: 59,860,174 E802* probably null Het
Barhl2 T C 5: 106,457,706 S46G unknown Het
Cacna1e A G 1: 154,444,000 V1318A probably damaging Het
Ccdc69 T C 11: 55,051,153 R176G probably null Het
Cdan1 T C 2: 120,729,799 N321S probably damaging Het
Cep85l T C 10: 53,278,154 D681G probably damaging Het
Csmd3 C T 15: 47,585,660 G3646E probably damaging Het
Cx3cl1 A G 8: 94,780,161 probably null Het
Dab1 A T 4: 104,328,298 probably benign Het
Dennd2c T C 3: 103,132,036 S167P possibly damaging Het
Dock2 A G 11: 34,232,767 probably null Het
Dok3 GCC GC 13: 55,524,355 probably null Het
Ebf1 A T 11: 44,908,008 I287L possibly damaging Het
Eci1 G A 17: 24,426,747 probably null Het
Emb T A 13: 117,249,706 I133N possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbn2 T C 18: 58,050,276 D1779G probably benign Het
Fgfr4 T A 13: 55,167,792 probably null Het
Flt1 G A 5: 147,655,119 T511M probably benign Het
Gys1 T C 7: 45,440,032 L205P probably damaging Het
Hepacam2 A G 6: 3,483,379 V134A probably damaging Het
Htr3a A G 9: 48,900,933 V291A probably damaging Het
Ip6k3 T A 17: 27,145,079 T332S probably benign Het
Klra6 A T 6: 130,018,952 F148I probably damaging Het
Kntc1 T C 5: 123,789,099 S1206P probably benign Het
Mbnl2 T A 14: 120,389,050 C231S probably damaging Het
Mdn1 A T 4: 32,773,952 D5521V probably damaging Het
Mylip G A 13: 45,404,470 V52M possibly damaging Het
Naip6 A G 13: 100,308,255 S232P probably benign Het
Ndc80 T C 17: 71,501,555 K504R probably benign Het
Nf2 T C 11: 4,803,694 N220S possibly damaging Het
Nfasc T A 1: 132,611,632 I393F probably damaging Het
Olfr102 T C 17: 37,314,061 T108A probably benign Het
Pabpc1 T C 15: 36,608,340 Y56C probably damaging Het
Pcca A G 14: 122,701,130 K498R probably damaging Het
Phldb1 A G 9: 44,715,748 S467P probably damaging Het
Ptprn2 T C 12: 116,580,428 S47P probably benign Het
Rtca A T 3: 116,497,644 I229N possibly damaging Het
Sh3rf2 T A 18: 42,153,294 S617R probably damaging Het
Slc14a2 T G 18: 78,147,080 T885P possibly damaging Het
Sp100 A C 1: 85,699,636 T417P possibly damaging Het
Tat A T 8: 109,996,214 N303Y probably damaging Het
Tet2 A G 3: 133,480,131 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tnks1bp1 A G 2: 85,063,067 S1113G probably benign Het
Tspear G A 10: 77,869,673 E302K probably benign Het
Tulp3 A G 6: 128,337,759 L23P probably damaging Het
Vti1b T C 12: 79,165,033 E42G probably damaging Het
Yeats2 G T 16: 20,186,268 E333* probably null Het
Zfp455 T G 13: 67,207,009 C114G probably damaging Het
Zfp532 G A 18: 65,623,484 V163M possibly damaging Het
Zfp940 A T 7: 29,845,527 C318* probably null Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69319373 missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69310027 missense possibly damaging 0.90
groats UTSW 11 69309491 nonsense probably null
R0270:Cntrob UTSW 11 69311341 missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69322868 missense probably damaging 1.00
R1775:Cntrob UTSW 11 69320867 missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69308054 missense probably benign 0.27
R1967:Cntrob UTSW 11 69320963 missense probably damaging 0.97
R2495:Cntrob UTSW 11 69322923 missense probably damaging 0.96
R3121:Cntrob UTSW 11 69322700 nonsense probably null
R3780:Cntrob UTSW 11 69302882 missense probably damaging 0.97
R4449:Cntrob UTSW 11 69305549 missense probably benign 0.29
R4696:Cntrob UTSW 11 69320888 missense probably damaging 1.00
R4841:Cntrob UTSW 11 69315394 missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69315394 missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69320906 missense probably damaging 0.97
R4982:Cntrob UTSW 11 69311362 unclassified probably null
R5168:Cntrob UTSW 11 69299990 missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69321891 missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69314750 missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69322753 missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69309375 missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69311422 missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69322923 missense probably damaging 0.96
R6964:Cntrob UTSW 11 69309491 nonsense probably null
R7020:Cntrob UTSW 11 69303092 critical splice donor site probably null
R7425:Cntrob UTSW 11 69314734 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATGAAAGCCCTGTGTGCTTG -3'
(R):5'- AGTCAGTGGACACTCCTCTAACCAG -3'

Sequencing Primer
(F):5'- GCCCAGGAACCTAATGCTTTC -3'
(R):5'- GCTCATTTGTTGAGGACCCAAAG -3'
Posted On2014-05-23