Incidental Mutation 'R1749:Ptprn2'
ID194215
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Nameprotein tyrosine phosphatase, receptor type, N polypeptide 2
Synonymsphogrin, 4930425H11Rik, IA-2 beta, PTP-NP, IA-2beta
MMRRC Submission 039781-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R1749 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location116485720-117276849 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116580428 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 47 (S47P)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
Predicted Effect probably benign
Transcript: ENSMUST00000070733
AA Change: S47P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: S47P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189009
Predicted Effect probably benign
Transcript: ENSMUST00000190247
AA Change: S47P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: S47P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191106
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A T 3: 152,472,920 M486K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Aspn A T 13: 49,551,785 D41V probably benign Het
Atp8a2 C A 14: 59,860,174 E802* probably null Het
Barhl2 T C 5: 106,457,706 S46G unknown Het
Cacna1e A G 1: 154,444,000 V1318A probably damaging Het
Ccdc69 T C 11: 55,051,153 R176G probably null Het
Cdan1 T C 2: 120,729,799 N321S probably damaging Het
Cep85l T C 10: 53,278,154 D681G probably damaging Het
Cntrob A T 11: 69,322,874 V30E probably damaging Het
Csmd3 C T 15: 47,585,660 G3646E probably damaging Het
Cx3cl1 A G 8: 94,780,161 probably null Het
Dab1 A T 4: 104,328,298 probably benign Het
Dennd2c T C 3: 103,132,036 S167P possibly damaging Het
Dock2 A G 11: 34,232,767 probably null Het
Dok3 GCC GC 13: 55,524,355 probably null Het
Ebf1 A T 11: 44,908,008 I287L possibly damaging Het
Eci1 G A 17: 24,426,747 probably null Het
Emb T A 13: 117,249,706 I133N possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbn2 T C 18: 58,050,276 D1779G probably benign Het
Fgfr4 T A 13: 55,167,792 probably null Het
Flt1 G A 5: 147,655,119 T511M probably benign Het
Gys1 T C 7: 45,440,032 L205P probably damaging Het
Hepacam2 A G 6: 3,483,379 V134A probably damaging Het
Htr3a A G 9: 48,900,933 V291A probably damaging Het
Ip6k3 T A 17: 27,145,079 T332S probably benign Het
Klra6 A T 6: 130,018,952 F148I probably damaging Het
Kntc1 T C 5: 123,789,099 S1206P probably benign Het
Mbnl2 T A 14: 120,389,050 C231S probably damaging Het
Mdn1 A T 4: 32,773,952 D5521V probably damaging Het
Mylip G A 13: 45,404,470 V52M possibly damaging Het
Naip6 A G 13: 100,308,255 S232P probably benign Het
Ndc80 T C 17: 71,501,555 K504R probably benign Het
Nf2 T C 11: 4,803,694 N220S possibly damaging Het
Nfasc T A 1: 132,611,632 I393F probably damaging Het
Olfr102 T C 17: 37,314,061 T108A probably benign Het
Pabpc1 T C 15: 36,608,340 Y56C probably damaging Het
Pcca A G 14: 122,701,130 K498R probably damaging Het
Phldb1 A G 9: 44,715,748 S467P probably damaging Het
Rtca A T 3: 116,497,644 I229N possibly damaging Het
Sh3rf2 T A 18: 42,153,294 S617R probably damaging Het
Slc14a2 T G 18: 78,147,080 T885P possibly damaging Het
Sp100 A C 1: 85,699,636 T417P possibly damaging Het
Tat A T 8: 109,996,214 N303Y probably damaging Het
Tet2 A G 3: 133,480,131 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tnks1bp1 A G 2: 85,063,067 S1113G probably benign Het
Tspear G A 10: 77,869,673 E302K probably benign Het
Tulp3 A G 6: 128,337,759 L23P probably damaging Het
Vti1b T C 12: 79,165,033 E42G probably damaging Het
Yeats2 G T 16: 20,186,268 E333* probably null Het
Zfp455 T G 13: 67,207,009 C114G probably damaging Het
Zfp532 G A 18: 65,623,484 V163M possibly damaging Het
Zfp940 A T 7: 29,845,527 C318* probably null Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116841388 missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116900987 missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116873697 splice site probably benign
IGL02339:Ptprn2 APN 12 116722104 missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116888898 missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117211943 missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116876344 nonsense probably null
BB001:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117248688 missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117276602 missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117211846 splice site probably benign
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116722091 missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117211846 splice site probably benign
R0694:Ptprn2 UTSW 12 116824355 missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116722130 nonsense probably null
R0746:Ptprn2 UTSW 12 116901017 missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117212008 splice site probably null
R1443:Ptprn2 UTSW 12 117253615 missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117184722 missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117161709 missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116722172 missense possibly damaging 0.64
R2075:Ptprn2 UTSW 12 117247717 missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116722133 missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116888877 missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116901008 missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116876000 missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116872094 missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116824396 missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117247773 nonsense probably null
R4872:Ptprn2 UTSW 12 117161694 missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117233365 splice site probably null
R4970:Ptprn2 UTSW 12 117276595 missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116858928 missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117211862 missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117184647 missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117255595 missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116859119 missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116876180 missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117269589 missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116872038 missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117227200 missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116888888 missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116872056 missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117227225 splice site probably null
R7237:Ptprn2 UTSW 12 117161727 missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117248544 missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116858951 missense probably benign
R7460:Ptprn2 UTSW 12 117248681 missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116485866 start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116722119 missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116841320 missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116841264 missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117184737 missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117255548 missense possibly damaging 0.73
X0066:Ptprn2 UTSW 12 117161760 missense probably damaging 1.00
X0066:Ptprn2 UTSW 12 117184740 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTGAAGGCACAGGACATGCCAC -3'
(R):5'- ACTGAGGCTGATAGGCACTGAGAC -3'

Sequencing Primer
(F):5'- CTCCTGATAGACAGGTTGTCCAG -3'
(R):5'- ACTGAGACACACATCTGTGAG -3'
Posted On2014-05-23