Incidental Mutation 'R1749:Ptprn2'
ID 194215
Institutional Source Beutler Lab
Gene Symbol Ptprn2
Ensembl Gene ENSMUSG00000056553
Gene Name protein tyrosine phosphatase receptor type N polypeptide 2
Synonyms IA-2 beta, PTP-NP, 4930425H11Rik, IA-2beta, phogrin
MMRRC Submission 039781-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.170) question?
Stock # R1749 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 116449340-117240469 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 116544048 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 47 (S47P)
Ref Sequence ENSEMBL: ENSMUSP00000139978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070733] [ENSMUST00000190247]
AlphaFold P80560
Predicted Effect probably benign
Transcript: ENSMUST00000070733
AA Change: S47P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064046
Gene: ENSMUSG00000056553
AA Change: S47P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 495 583 1.5e-35 PFAM
low complexity region 687 707 N/A INTRINSIC
PTPc 730 993 4.42e-119 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189009
Predicted Effect probably benign
Transcript: ENSMUST00000190247
AA Change: S47P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139978
Gene: ENSMUSG00000056553
AA Change: S47P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
RESP18 58 157 1.9e-40 SMART
low complexity region 393 426 N/A INTRINSIC
Pfam:Receptor_IA-2 494 584 2.5e-43 PFAM
transmembrane domain 602 624 N/A INTRINSIC
low complexity region 687 707 N/A INTRINSIC
PTPc 730 932 8.81e-64 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191106
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to receptor-like protein tyrosine phosphatases. However, tyrosine phosphatase activity has not been experimentally validated for this protein. Studies of the rat ortholog suggest that the encoded protein may instead function as a phosphatidylinositol phosphatase with the ability to dephosphorylate phosphatidylinositol 3-phosphate and phosphatidylinositol 4,5-diphosphate, and this function may be involved in the regulation of insulin secretion. This protein has been identified as an autoantigen in insulin-dependent diabetes mellitus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygous null mice display impaired glucose tolerance but normal fasting and non-fasting blood glucose and insulin levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A T 3: 152,178,557 (GRCm39) M486K probably damaging Het
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Aspn A T 13: 49,705,261 (GRCm39) D41V probably benign Het
Atp8a2 C A 14: 60,097,623 (GRCm39) E802* probably null Het
Barhl2 T C 5: 106,605,572 (GRCm39) S46G unknown Het
Cacna1e A G 1: 154,319,746 (GRCm39) V1318A probably damaging Het
Ccdc69 T C 11: 54,941,979 (GRCm39) R176G probably null Het
Cdan1 T C 2: 120,560,280 (GRCm39) N321S probably damaging Het
Cep85l T C 10: 53,154,250 (GRCm39) D681G probably damaging Het
Cntrob A T 11: 69,213,700 (GRCm39) V30E probably damaging Het
Csmd3 C T 15: 47,449,056 (GRCm39) G3646E probably damaging Het
Cx3cl1 A G 8: 95,506,789 (GRCm39) probably null Het
Dab1 A T 4: 104,185,495 (GRCm39) probably benign Het
Dennd2c T C 3: 103,039,352 (GRCm39) S167P possibly damaging Het
Dock2 A G 11: 34,182,767 (GRCm39) probably null Het
Dok3 GCC GC 13: 55,672,168 (GRCm39) probably null Het
Ebf1 A T 11: 44,798,835 (GRCm39) I287L possibly damaging Het
Eci1 G A 17: 24,645,721 (GRCm39) probably null Het
Emb T A 13: 117,386,242 (GRCm39) I133N possibly damaging Het
Fam91a1 A G 15: 58,298,443 (GRCm39) I184V probably benign Het
Fbn2 T C 18: 58,183,348 (GRCm39) D1779G probably benign Het
Fgfr4 T A 13: 55,315,605 (GRCm39) probably null Het
Flt1 G A 5: 147,591,929 (GRCm39) T511M probably benign Het
Gys1 T C 7: 45,089,456 (GRCm39) L205P probably damaging Het
Hepacam2 A G 6: 3,483,379 (GRCm39) V134A probably damaging Het
Htr3a A G 9: 48,812,233 (GRCm39) V291A probably damaging Het
Ip6k3 T A 17: 27,364,053 (GRCm39) T332S probably benign Het
Klra6 A T 6: 129,995,915 (GRCm39) F148I probably damaging Het
Kntc1 T C 5: 123,927,162 (GRCm39) S1206P probably benign Het
Mbnl2 T A 14: 120,626,462 (GRCm39) C231S probably damaging Het
Mdn1 A T 4: 32,773,952 (GRCm39) D5521V probably damaging Het
Mylip G A 13: 45,557,946 (GRCm39) V52M possibly damaging Het
Naip6 A G 13: 100,444,763 (GRCm39) S232P probably benign Het
Ndc80 T C 17: 71,808,550 (GRCm39) K504R probably benign Het
Nf2 T C 11: 4,753,694 (GRCm39) N220S possibly damaging Het
Nfasc T A 1: 132,539,370 (GRCm39) I393F probably damaging Het
Or12d2 T C 17: 37,624,952 (GRCm39) T108A probably benign Het
Pabpc1 T C 15: 36,608,584 (GRCm39) Y56C probably damaging Het
Pcca A G 14: 122,938,542 (GRCm39) K498R probably damaging Het
Phldb1 A G 9: 44,627,045 (GRCm39) S467P probably damaging Het
Rtca A T 3: 116,291,293 (GRCm39) I229N possibly damaging Het
Sh3rf2 T A 18: 42,286,359 (GRCm39) S617R probably damaging Het
Slc14a2 T G 18: 78,190,295 (GRCm39) T885P possibly damaging Het
Sp100 A C 1: 85,627,357 (GRCm39) T417P possibly damaging Het
Tat A T 8: 110,722,846 (GRCm39) N303Y probably damaging Het
Tet2 A G 3: 133,185,892 (GRCm39) probably null Het
Tln2 C T 9: 67,193,796 (GRCm39) A1773T probably benign Het
Tnks1bp1 A G 2: 84,893,411 (GRCm39) S1113G probably benign Het
Tspear G A 10: 77,705,507 (GRCm39) E302K probably benign Het
Tulp3 A G 6: 128,314,722 (GRCm39) L23P probably damaging Het
Vti1b T C 12: 79,211,807 (GRCm39) E42G probably damaging Het
Yeats2 G T 16: 20,005,018 (GRCm39) E333* probably null Het
Zfp455 T G 13: 67,355,073 (GRCm39) C114G probably damaging Het
Zfp532 G A 18: 65,756,555 (GRCm39) V163M possibly damaging Het
Zfp940 A T 7: 29,544,952 (GRCm39) C318* probably null Het
Other mutations in Ptprn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01695:Ptprn2 APN 12 116,805,008 (GRCm39) missense probably benign 0.02
IGL01788:Ptprn2 APN 12 116,864,607 (GRCm39) missense probably damaging 0.98
IGL02172:Ptprn2 APN 12 116,837,317 (GRCm39) splice site probably benign
IGL02339:Ptprn2 APN 12 116,685,724 (GRCm39) missense probably damaging 1.00
IGL02706:Ptprn2 APN 12 116,852,518 (GRCm39) missense probably damaging 0.96
IGL03018:Ptprn2 APN 12 117,175,563 (GRCm39) missense probably damaging 1.00
IGL03267:Ptprn2 APN 12 116,839,964 (GRCm39) nonsense probably null
BB001:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
BB011:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
IGL03014:Ptprn2 UTSW 12 117,212,308 (GRCm39) missense probably damaging 1.00
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0066:Ptprn2 UTSW 12 117,240,222 (GRCm39) missense probably benign 0.07
R0115:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0131:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0132:Ptprn2 UTSW 12 116,685,711 (GRCm39) missense probably damaging 1.00
R0481:Ptprn2 UTSW 12 117,175,466 (GRCm39) splice site probably benign
R0694:Ptprn2 UTSW 12 116,787,975 (GRCm39) missense possibly damaging 0.69
R0698:Ptprn2 UTSW 12 116,685,750 (GRCm39) nonsense probably null
R0746:Ptprn2 UTSW 12 116,864,637 (GRCm39) missense probably benign 0.00
R1127:Ptprn2 UTSW 12 117,175,628 (GRCm39) splice site probably null
R1443:Ptprn2 UTSW 12 117,217,235 (GRCm39) missense probably damaging 1.00
R1508:Ptprn2 UTSW 12 117,148,342 (GRCm39) missense probably damaging 1.00
R1664:Ptprn2 UTSW 12 117,125,329 (GRCm39) missense probably damaging 0.99
R1670:Ptprn2 UTSW 12 116,685,792 (GRCm39) missense possibly damaging 0.64
R2075:Ptprn2 UTSW 12 117,211,337 (GRCm39) missense probably benign 0.01
R3054:Ptprn2 UTSW 12 116,685,753 (GRCm39) missense probably damaging 1.00
R3107:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3109:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R3552:Ptprn2 UTSW 12 116,852,497 (GRCm39) missense probably benign 0.00
R4193:Ptprn2 UTSW 12 116,864,628 (GRCm39) missense probably benign 0.01
R4523:Ptprn2 UTSW 12 116,839,620 (GRCm39) missense probably damaging 1.00
R4706:Ptprn2 UTSW 12 116,835,714 (GRCm39) missense probably benign 0.02
R4719:Ptprn2 UTSW 12 116,788,016 (GRCm39) missense possibly damaging 0.95
R4726:Ptprn2 UTSW 12 117,211,393 (GRCm39) nonsense probably null
R4872:Ptprn2 UTSW 12 117,125,314 (GRCm39) missense probably damaging 1.00
R4891:Ptprn2 UTSW 12 117,196,985 (GRCm39) splice site probably null
R4970:Ptprn2 UTSW 12 117,240,215 (GRCm39) missense probably damaging 1.00
R5208:Ptprn2 UTSW 12 116,822,548 (GRCm39) missense probably damaging 1.00
R5287:Ptprn2 UTSW 12 117,175,482 (GRCm39) missense probably damaging 1.00
R5419:Ptprn2 UTSW 12 117,148,267 (GRCm39) missense probably damaging 0.99
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6035:Ptprn2 UTSW 12 117,219,215 (GRCm39) missense probably damaging 1.00
R6180:Ptprn2 UTSW 12 116,822,739 (GRCm39) missense probably benign 0.05
R6277:Ptprn2 UTSW 12 116,839,800 (GRCm39) missense probably benign 0.04
R6465:Ptprn2 UTSW 12 117,233,209 (GRCm39) missense probably damaging 0.96
R6488:Ptprn2 UTSW 12 116,835,658 (GRCm39) missense probably benign 0.13
R6555:Ptprn2 UTSW 12 117,190,820 (GRCm39) missense probably damaging 1.00
R6908:Ptprn2 UTSW 12 116,852,508 (GRCm39) missense probably benign 0.06
R7120:Ptprn2 UTSW 12 116,835,676 (GRCm39) missense probably benign 0.01
R7229:Ptprn2 UTSW 12 117,190,845 (GRCm39) splice site probably null
R7237:Ptprn2 UTSW 12 117,125,347 (GRCm39) missense probably benign 0.03
R7304:Ptprn2 UTSW 12 117,212,164 (GRCm39) missense probably damaging 1.00
R7355:Ptprn2 UTSW 12 116,822,571 (GRCm39) missense probably benign
R7460:Ptprn2 UTSW 12 117,212,301 (GRCm39) missense probably benign 0.05
R7577:Ptprn2 UTSW 12 116,449,486 (GRCm39) start codon destroyed probably null
R7658:Ptprn2 UTSW 12 116,685,739 (GRCm39) missense probably benign 0.01
R7666:Ptprn2 UTSW 12 116,804,940 (GRCm39) missense probably benign 0.10
R7924:Ptprn2 UTSW 12 116,804,884 (GRCm39) missense probably benign 0.00
R8219:Ptprn2 UTSW 12 117,148,357 (GRCm39) missense probably benign 0.30
R8716:Ptprn2 UTSW 12 117,219,168 (GRCm39) missense possibly damaging 0.73
R9235:Ptprn2 UTSW 12 117,233,271 (GRCm39) critical splice donor site probably null
R9605:Ptprn2 UTSW 12 117,125,278 (GRCm39) missense probably benign 0.13
X0066:Ptprn2 UTSW 12 117,148,360 (GRCm39) missense probably benign 0.16
X0066:Ptprn2 UTSW 12 117,125,380 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAAGGCACAGGACATGCCAC -3'
(R):5'- ACTGAGGCTGATAGGCACTGAGAC -3'

Sequencing Primer
(F):5'- CTCCTGATAGACAGGTTGTCCAG -3'
(R):5'- ACTGAGACACACATCTGTGAG -3'
Posted On 2014-05-23