Incidental Mutation 'R1749:Zfp455'
ID194220
Institutional Source Beutler Lab
Gene Symbol Zfp455
Ensembl Gene ENSMUSG00000051037
Gene Namezinc finger protein 455
SynonymsRslcan-10, 3732412P20Rik
MMRRC Submission 039781-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R1749 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location67194506-67209298 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 67207009 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 114 (C114G)
Ref Sequence ENSEMBL: ENSMUSP00000112546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117110] [ENSMUST00000120861]
Predicted Effect probably damaging
Transcript: ENSMUST00000117110
AA Change: C49G

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113356
Gene: ENSMUSG00000051037
AA Change: C49G

DomainStartEndE-ValueType
ZnF_C2H2 44 66 7.15e-2 SMART
ZnF_C2H2 72 94 1.6e-4 SMART
ZnF_C2H2 100 122 2.12e-4 SMART
ZnF_C2H2 128 150 6.23e-2 SMART
ZnF_C2H2 184 206 1.01e-1 SMART
ZnF_C2H2 212 234 3.11e-2 SMART
ZnF_C2H2 240 262 1.1e-2 SMART
ZnF_C2H2 268 290 1.38e-3 SMART
ZnF_C2H2 296 318 3.58e-2 SMART
ZnF_C2H2 324 346 2.24e-3 SMART
ZnF_C2H2 352 374 7.9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120861
AA Change: C114G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112546
Gene: ENSMUSG00000051037
AA Change: C114G

DomainStartEndE-ValueType
KRAB 5 65 1.92e-34 SMART
ZnF_C2H2 109 131 7.15e-2 SMART
ZnF_C2H2 137 159 1.6e-4 SMART
ZnF_C2H2 165 187 2.12e-4 SMART
ZnF_C2H2 193 215 6.23e-2 SMART
ZnF_C2H2 249 271 1.01e-1 SMART
ZnF_C2H2 277 299 3.11e-2 SMART
ZnF_C2H2 305 327 1.1e-2 SMART
ZnF_C2H2 333 355 1.38e-3 SMART
ZnF_C2H2 361 383 3.58e-2 SMART
ZnF_C2H2 389 411 2.24e-3 SMART
ZnF_C2H2 417 439 7.9e-4 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A T 3: 152,472,920 M486K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Aspn A T 13: 49,551,785 D41V probably benign Het
Atp8a2 C A 14: 59,860,174 E802* probably null Het
Barhl2 T C 5: 106,457,706 S46G unknown Het
Cacna1e A G 1: 154,444,000 V1318A probably damaging Het
Ccdc69 T C 11: 55,051,153 R176G probably null Het
Cdan1 T C 2: 120,729,799 N321S probably damaging Het
Cep85l T C 10: 53,278,154 D681G probably damaging Het
Cntrob A T 11: 69,322,874 V30E probably damaging Het
Csmd3 C T 15: 47,585,660 G3646E probably damaging Het
Cx3cl1 A G 8: 94,780,161 probably null Het
Dab1 A T 4: 104,328,298 probably benign Het
Dennd2c T C 3: 103,132,036 S167P possibly damaging Het
Dock2 A G 11: 34,232,767 probably null Het
Dok3 GCC GC 13: 55,524,355 probably null Het
Ebf1 A T 11: 44,908,008 I287L possibly damaging Het
Eci1 G A 17: 24,426,747 probably null Het
Emb T A 13: 117,249,706 I133N possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbn2 T C 18: 58,050,276 D1779G probably benign Het
Fgfr4 T A 13: 55,167,792 probably null Het
Flt1 G A 5: 147,655,119 T511M probably benign Het
Gys1 T C 7: 45,440,032 L205P probably damaging Het
Hepacam2 A G 6: 3,483,379 V134A probably damaging Het
Htr3a A G 9: 48,900,933 V291A probably damaging Het
Ip6k3 T A 17: 27,145,079 T332S probably benign Het
Klra6 A T 6: 130,018,952 F148I probably damaging Het
Kntc1 T C 5: 123,789,099 S1206P probably benign Het
Mbnl2 T A 14: 120,389,050 C231S probably damaging Het
Mdn1 A T 4: 32,773,952 D5521V probably damaging Het
Mylip G A 13: 45,404,470 V52M possibly damaging Het
Naip6 A G 13: 100,308,255 S232P probably benign Het
Ndc80 T C 17: 71,501,555 K504R probably benign Het
Nf2 T C 11: 4,803,694 N220S possibly damaging Het
Nfasc T A 1: 132,611,632 I393F probably damaging Het
Olfr102 T C 17: 37,314,061 T108A probably benign Het
Pabpc1 T C 15: 36,608,340 Y56C probably damaging Het
Pcca A G 14: 122,701,130 K498R probably damaging Het
Phldb1 A G 9: 44,715,748 S467P probably damaging Het
Ptprn2 T C 12: 116,580,428 S47P probably benign Het
Rtca A T 3: 116,497,644 I229N possibly damaging Het
Sh3rf2 T A 18: 42,153,294 S617R probably damaging Het
Slc14a2 T G 18: 78,147,080 T885P possibly damaging Het
Sp100 A C 1: 85,699,636 T417P possibly damaging Het
Tat A T 8: 109,996,214 N303Y probably damaging Het
Tet2 A G 3: 133,480,131 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tnks1bp1 A G 2: 85,063,067 S1113G probably benign Het
Tspear G A 10: 77,869,673 E302K probably benign Het
Tulp3 A G 6: 128,337,759 L23P probably damaging Het
Vti1b T C 12: 79,165,033 E42G probably damaging Het
Yeats2 G T 16: 20,186,268 E333* probably null Het
Zfp532 G A 18: 65,623,484 V163M possibly damaging Het
Zfp940 A T 7: 29,845,527 C318* probably null Het
Other mutations in Zfp455
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Zfp455 APN 13 67207898 missense probably benign 0.33
IGL03111:Zfp455 APN 13 67207999 missense probably benign 0.00
IGL03210:Zfp455 APN 13 67207049 missense possibly damaging 0.93
IGL03371:Zfp455 APN 13 67207002 nonsense probably null
PIT4504001:Zfp455 UTSW 13 67198621 missense probably damaging 0.98
R0245:Zfp455 UTSW 13 67207835 missense probably damaging 1.00
R0277:Zfp455 UTSW 13 67198664 splice site probably null
R1141:Zfp455 UTSW 13 67198591 missense probably damaging 1.00
R1266:Zfp455 UTSW 13 67206964 nonsense probably null
R1657:Zfp455 UTSW 13 67198639 missense possibly damaging 0.83
R1757:Zfp455 UTSW 13 67207537 missense probably damaging 1.00
R1854:Zfp455 UTSW 13 67207817 missense probably damaging 1.00
R1867:Zfp455 UTSW 13 67207445 missense probably benign 0.33
R4411:Zfp455 UTSW 13 67207325 missense probably damaging 0.96
R6060:Zfp455 UTSW 13 67207193 missense probably damaging 1.00
R6544:Zfp455 UTSW 13 67207057 missense probably benign 0.33
R7132:Zfp455 UTSW 13 67199166 missense probably damaging 1.00
R7524:Zfp455 UTSW 13 67207624 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GCATTGTGTCCACCGACTGTATTTGT -3'
(R):5'- GTTGCTTAAGGAATGAGGGAAAGCCA -3'

Sequencing Primer
(F):5'- GAATTTTCCTCAGTGCCTACAGG -3'
(R):5'- ttccacattcttcacacttgc -3'
Posted On2014-05-23