Incidental Mutation 'R1749:Pcca'
ID194227
Institutional Source Beutler Lab
Gene Symbol Pcca
Ensembl Gene ENSMUSG00000041650
Gene Namepropionyl-Coenzyme A carboxylase, alpha polypeptide
SynonymsC79630
MMRRC Submission 039781-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1749 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location122534324-122891100 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122701130 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 498 (K498R)
Ref Sequence ENSEMBL: ENSMUSP00000038763 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038374]
Predicted Effect probably damaging
Transcript: ENSMUST00000038374
AA Change: K498R

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038763
Gene: ENSMUSG00000041650
AA Change: K498R

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 58 167 2.1e-48 PFAM
Pfam:ATP-grasp_4 169 351 3.8e-15 PFAM
Pfam:RimK 170 372 5.6e-7 PFAM
Pfam:CPSase_L_D2 172 381 2.8e-87 PFAM
Pfam:ATP-grasp 181 351 9.8e-10 PFAM
Pfam:Dala_Dala_lig_C 192 349 7.7e-12 PFAM
Biotin_carb_C 393 501 4.27e-46 SMART
Pfam:Biotin_lipoyl 656 723 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177312
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the alpha subunit of the heterodimeric mitochondrial enzyme Propionyl-CoA carboxylase. PCCA encodes the biotin-binding region of this enzyme. Mutations in either PCCA or PCCB (encoding the beta subunit) lead to an enzyme deficiency resulting in propionic acidemia. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice die 24-36 hours after birth due to accelerated ketoacidosis. Death is preceded by reduced milk intake, poor movement, dehydration, accumulation of propionyl-CoA, ketonuria, increased fat deposition and glycogen consumption in liver, and enlarged kidney collecting ducts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ak5 A T 3: 152,472,920 M486K probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Aspn A T 13: 49,551,785 D41V probably benign Het
Atp8a2 C A 14: 59,860,174 E802* probably null Het
Barhl2 T C 5: 106,457,706 S46G unknown Het
Cacna1e A G 1: 154,444,000 V1318A probably damaging Het
Ccdc69 T C 11: 55,051,153 R176G probably null Het
Cdan1 T C 2: 120,729,799 N321S probably damaging Het
Cep85l T C 10: 53,278,154 D681G probably damaging Het
Cntrob A T 11: 69,322,874 V30E probably damaging Het
Csmd3 C T 15: 47,585,660 G3646E probably damaging Het
Cx3cl1 A G 8: 94,780,161 probably null Het
Dab1 A T 4: 104,328,298 probably benign Het
Dennd2c T C 3: 103,132,036 S167P possibly damaging Het
Dock2 A G 11: 34,232,767 probably null Het
Dok3 GCC GC 13: 55,524,355 probably null Het
Ebf1 A T 11: 44,908,008 I287L possibly damaging Het
Eci1 G A 17: 24,426,747 probably null Het
Emb T A 13: 117,249,706 I133N possibly damaging Het
Fam91a1 A G 15: 58,426,594 I184V probably benign Het
Fbn2 T C 18: 58,050,276 D1779G probably benign Het
Fgfr4 T A 13: 55,167,792 probably null Het
Flt1 G A 5: 147,655,119 T511M probably benign Het
Gys1 T C 7: 45,440,032 L205P probably damaging Het
Hepacam2 A G 6: 3,483,379 V134A probably damaging Het
Htr3a A G 9: 48,900,933 V291A probably damaging Het
Ip6k3 T A 17: 27,145,079 T332S probably benign Het
Klra6 A T 6: 130,018,952 F148I probably damaging Het
Kntc1 T C 5: 123,789,099 S1206P probably benign Het
Mbnl2 T A 14: 120,389,050 C231S probably damaging Het
Mdn1 A T 4: 32,773,952 D5521V probably damaging Het
Mylip G A 13: 45,404,470 V52M possibly damaging Het
Naip6 A G 13: 100,308,255 S232P probably benign Het
Ndc80 T C 17: 71,501,555 K504R probably benign Het
Nf2 T C 11: 4,803,694 N220S possibly damaging Het
Nfasc T A 1: 132,611,632 I393F probably damaging Het
Olfr102 T C 17: 37,314,061 T108A probably benign Het
Pabpc1 T C 15: 36,608,340 Y56C probably damaging Het
Phldb1 A G 9: 44,715,748 S467P probably damaging Het
Ptprn2 T C 12: 116,580,428 S47P probably benign Het
Rtca A T 3: 116,497,644 I229N possibly damaging Het
Sh3rf2 T A 18: 42,153,294 S617R probably damaging Het
Slc14a2 T G 18: 78,147,080 T885P possibly damaging Het
Sp100 A C 1: 85,699,636 T417P possibly damaging Het
Tat A T 8: 109,996,214 N303Y probably damaging Het
Tet2 A G 3: 133,480,131 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tnks1bp1 A G 2: 85,063,067 S1113G probably benign Het
Tspear G A 10: 77,869,673 E302K probably benign Het
Tulp3 A G 6: 128,337,759 L23P probably damaging Het
Vti1b T C 12: 79,165,033 E42G probably damaging Het
Yeats2 G T 16: 20,186,268 E333* probably null Het
Zfp455 T G 13: 67,207,009 C114G probably damaging Het
Zfp532 G A 18: 65,623,484 V163M possibly damaging Het
Zfp940 A T 7: 29,845,527 C318* probably null Het
Other mutations in Pcca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pcca APN 14 122582629 missense probably benign 0.22
IGL00906:Pcca APN 14 122690133 missense probably benign 0.34
IGL00975:Pcca APN 14 122876900 missense probably damaging 1.00
IGL01329:Pcca APN 14 122690133 missense possibly damaging 0.50
IGL01353:Pcca APN 14 122582617 missense probably damaging 0.98
IGL01672:Pcca APN 14 122690145 missense probably benign 0.02
IGL02621:Pcca APN 14 122684979 missense probably damaging 0.99
IGL02695:Pcca APN 14 122582738 splice site probably benign
IGL02749:Pcca APN 14 122534388 missense probably benign 0.00
IGL02971:Pcca APN 14 122889533 missense probably damaging 0.96
IGL03290:Pcca APN 14 122585106 missense possibly damaging 0.52
IGL03052:Pcca UTSW 14 122887101 missense probably benign
PIT4812001:Pcca UTSW 14 122790382 missense probably benign 0.00
R0549:Pcca UTSW 14 122638377 splice site probably benign
R0866:Pcca UTSW 14 122889545 missense possibly damaging 0.95
R1498:Pcca UTSW 14 122616818 missense probably damaging 1.00
R2002:Pcca UTSW 14 122887065 missense probably benign 0.00
R2020:Pcca UTSW 14 122813222 missense possibly damaging 0.64
R2086:Pcca UTSW 14 122686115 missense probably damaging 0.99
R3780:Pcca UTSW 14 122684885 missense probably damaging 1.00
R5023:Pcca UTSW 14 122790398 missense probably damaging 1.00
R5643:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5644:Pcca UTSW 14 122887069 missense probably damaging 1.00
R5943:Pcca UTSW 14 122658776 missense probably damaging 0.99
R5966:Pcca UTSW 14 122668586 missense probably damaging 0.96
R6295:Pcca UTSW 14 122658775 missense probably benign 0.10
R6317:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6319:Pcca UTSW 14 122582623 missense probably damaging 1.00
R6361:Pcca UTSW 14 122638382 missense probably benign 0.07
R6989:Pcca UTSW 14 122650288 missense probably damaging 1.00
R7243:Pcca UTSW 14 122876774 missense probably benign
RF024:Pcca UTSW 14 122684898 missense probably damaging 1.00
X0026:Pcca UTSW 14 122616791 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- TCCAGAAGCCCCTAAAAGGAGGAAA -3'
(R):5'- GGAACAGAAGCCAAAAGACCTTCACT -3'

Sequencing Primer
(F):5'- gggaaagaggaggaggagag -3'
(R):5'- GACCTTCACTCAAAATAGAAAAGTTG -3'
Posted On2014-05-23