Mutagenetix > Incidental Mutation

Incidental Mutation 'R1765:Adamtsl2'

194249

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

MMRRC Submission

039797-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1765 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 27102830 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 652 (I652L)

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

AlphaFold

Q7TSK7

Predicted Effect

probably benign
Transcript: ENSMUST00000091233
AA Change: I652L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: I652L

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130600

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139633

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169787

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 95.1%
20x: 91.8%

Validation Efficiency

99% (90/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110043O21Rik	A	C	4: 35,197,098	H322Q	probably damaging	Het
4933412E24Rik	G	T	15: 60,015,345	C415*	probably null	Het
A430105I19Rik	G	A	2: 118,760,647	A135V	probably benign	Het
Adgrl4	T	C	3: 151,543,235	I720T	probably damaging	Het
Agrn	A	T	4: 156,176,827	C604*	probably null	Het
Amh	AGCGCCTTGG	AG	10: 80,805,585		probably null	Het
B3galt2	C	A	1: 143,646,469	N114K	probably benign	Het
Bud23	A	T	5: 135,056,043	M59K	probably benign	Het
C3	C	T	17: 57,224,401		probably null	Het
Cc2d2a	A	T	5: 43,714,531	D903V	probably damaging	Het
Ccdc105	A	T	10: 78,748,668	M340K	probably benign	Het
Cd84	A	G	1: 171,872,750	T145A	possibly damaging	Het
Cdan1	A	C	2: 120,720,749	L1097V	probably damaging	Het
Cdc26	T	A	4: 62,394,918	N62I	probably benign	Het
Cdc27	G	T	11: 104,534,781	Q70K	probably damaging	Het
Cenpq	A	T	17: 40,924,287		probably null	Het
Cep295	T	C	9: 15,327,904	S1858G	probably damaging	Het
Clasp1	T	C	1: 118,505,531	S247P	probably damaging	Het
Cyp2w1	C	T	5: 139,353,868	T71I	probably damaging	Het
Dcaf1	T	C	9: 106,864,594	F1336S	probably damaging	Het
Dennd6b	G	A	15: 89,190,303	Q104*	probably null	Het
Dglucy	T	A	12: 100,850,102		probably null	Het
Dnajc9	A	G	14: 20,388,090	V148A	possibly damaging	Het
Dnmbp	T	A	19: 43,902,140	D396V	possibly damaging	Het
Dock10	T	A	1: 80,605,823	I221F	probably damaging	Het
Dscam	T	C	16: 96,685,379	N1032S	probably benign	Het
Dsg4	A	C	18: 20,456,831	Y346S	probably benign	Het
Dync1i2	A	G	2: 71,249,415	H417R	probably benign	Het
Dysf	G	A	6: 84,190,902		probably null	Het
Elovl1	A	G	4: 118,430,510	M1V	probably null	Het
Eva1c	A	G	16: 90,904,247	S257G	probably benign	Het
Eya2	A	T	2: 165,724,803	D258V	probably damaging	Het
Fam193a	A	G	5: 34,436,497	T113A	probably damaging	Het
Fbxw15	G	A	9: 109,558,246	S227F	probably damaging	Het
Fstl5	G	T	3: 76,593,476	R404L	possibly damaging	Het
Glud1	T	C	14: 34,325,584		probably benign	Het
Gm10770	A	C	2: 150,179,338	H86Q	probably damaging	Het
Gm13757	A	T	2: 88,446,023	F305Y	probably damaging	Het
Gm5724	T	C	6: 141,754,358		probably benign	Het
Gzme	C	T	14: 56,118,414	G147D	probably damaging	Het
Herc3	T	C	6: 58,888,660	V746A	probably damaging	Het
Hmga1	A	G	17: 27,559,618	E17G	probably damaging	Het
Kdelr2	A	T	5: 143,420,812	K206*	probably null	Het
Kng2	A	G	16: 22,988,243		probably null	Het
Lrrc41	G	A	4: 116,089,051	R321H	possibly damaging	Het
Mapkapk2	A	T	1: 131,058,761	M1K	probably null	Het
Me2	A	G	18: 73,791,858	F263L	probably damaging	Het
Mkks	A	G	2: 136,880,367	L290P	probably damaging	Het
Mmp12	T	A	9: 7,354,772	I255N	probably damaging	Het
Mogs	A	G	6: 83,116,803	D251G	probably benign	Het
Morf4l1	T	A	9: 90,102,348	Y65F	possibly damaging	Het
Neb	T	C	2: 52,204,664	D5169G	probably damaging	Het
Nin	A	G	12: 70,042,891	L1250P	probably damaging	Het
Nomo1	G	T	7: 46,066,293	G721V	possibly damaging	Het
Notch2	T	G	3: 98,121,926	C1002G	probably damaging	Het
Npat	T	C	9: 53,570,222	Y1077H	probably benign	Het
Olfr1284	G	A	2: 111,379,146	V49I	probably benign	Het
Olfr193	A	G	16: 59,109,755	L285P	probably damaging	Het
Olfr376	T	A	11: 73,375,344	N198K	probably damaging	Het
Olfr894	T	C	9: 38,219,252	I143T	probably benign	Het
Otop2	A	T	11: 115,324,678	I142F	probably benign	Het
Pacsin3	A	G	2: 91,263,115	E279G	possibly damaging	Het
Pafah2	A	G	4: 134,413,447	T243A	probably benign	Het
Pcdhgc5	A	G	18: 37,821,860	H729R	probably benign	Het
Plcd1	T	C	9: 119,071,806	D756G	probably damaging	Het
Prune2	A	G	19: 17,125,598	E2707G	probably damaging	Het
Rit2	C	T	18: 31,316,898	G16S	probably damaging	Het
Sec24c	A	G	14: 20,688,854		probably benign	Het
Skint5	G	T	4: 113,577,661	T1037K	unknown	Het
Slc28a2	T	A	2: 122,460,395		probably null	Het
Slc41a2	G	A	10: 83,301,266	A259V	probably damaging	Het
Slc6a17	T	A	3: 107,473,579	I537F	possibly damaging	Het
Smchd1	A	T	17: 71,400,201		probably benign	Het
Smg1	T	C	7: 118,139,715	I3489V	probably benign	Het
Sytl3	T	C	17: 6,699,683	L142P	probably damaging	Het
Tfr2	C	T	5: 137,583,445	T598I	probably damaging	Het
Tmc2	A	G	2: 130,260,225	Q770R	probably benign	Het
Tnc	C	T	4: 64,013,994	V728M	probably damaging	Het
Trim68	A	T	7: 102,680,390	M177K	possibly damaging	Het
Trmt11	T	C	10: 30,559,188	D325G	probably benign	Het
Ube3a	C	T	7: 59,286,114	T582I	probably damaging	Het
Usp13	G	A	3: 32,915,770	E682K	probably benign	Het
Usp9y	A	G	Y: 1,384,454	V688A	possibly damaging	Het
Uts2r	A	G	11: 121,161,269	T320A	possibly damaging	Het
Vmn1r34	A	T	6: 66,637,496	M86K	probably damaging	Het
Vsig10	A	G	5: 117,318,815		probably benign	Het
Zbtb41	T	A	1: 139,440,394	C607S	probably benign	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1183:Adamtsl2	UTSW	2	27084080	missense	probably damaging	1.00
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1675:Adamtsl2	UTSW	2	27082485	frame shift	probably null
R1698:Adamtsl2	UTSW	2	27103127	missense	possibly damaging	0.92
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R2232:Adamtsl2	UTSW	2	27103178	missense	probably damaging	1.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4518:Adamtsl2	UTSW	2	27095547	missense	probably benign	0.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4686:Adamtsl2	UTSW	2	27093825	missense	probably damaging	0.99
R4821:Adamtsl2	UTSW	2	27098592	splice site	probably null
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5460:Adamtsl2	UTSW	2	27095398	splice site	probably null
R5569:Adamtsl2	UTSW	2	27102833	missense	probably damaging	1.00
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R6836:Adamtsl2	UTSW	2	27081706	start codon destroyed	probably null	0.90
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R7437:Adamtsl2	UTSW	2	27089709	missense	probably damaging	0.99
R8089:Adamtsl2	UTSW	2	27104797	missense	probably benign	0.00
R8389:Adamtsl2	UTSW	2	27103124	missense	possibly damaging	0.71
R9284:Adamtsl2	UTSW	2	27104043	splice site	probably benign
R9566:Adamtsl2	UTSW	2	27089761	critical splice donor site	probably null
R9772:Adamtsl2	UTSW	2	27095654	missense	probably benign
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign
Z1176:Adamtsl2	UTSW	2	27081720	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGTTAACATGGGCACAGTCCACAC -3'
(R):5'- AGCGGATGTCTCTGGTCACTACAC -3'

Sequencing Primer
(F):5'- CACACTGGCAGGTCTCATC -3'
(R):5'- TGTTCTCAGGAACAGGCTAC -3'

Posted On

2014-05-23