Incidental Mutation 'R0035:Nos2'
ID 19428
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms Nos2a, NOS-II, Nos-2, iNOS
MMRRC Submission 038329-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0035 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 11
Chromosomal Location 78811613-78851052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 78836553 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 431 (S431P)
Ref Sequence ENSEMBL: ENSMUSP00000150558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
Predicted Effect probably damaging
Transcript: ENSMUST00000018610
AA Change: S544P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: S544P

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214397
AA Change: S431P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9640 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik T C 7: 81,438,297 (GRCm39) T20A probably benign Het
Aadacl4 A G 4: 144,344,511 (GRCm39) T96A probably damaging Het
Abcb6 A G 1: 75,151,651 (GRCm39) V473A possibly damaging Het
Abo C A 2: 26,733,385 (GRCm39) K273N possibly damaging Het
Acvr1c A G 2: 58,205,791 (GRCm39) probably benign Het
Adcy8 A T 15: 64,571,217 (GRCm39) V1142D probably benign Het
Akna T A 4: 63,300,682 (GRCm39) H591L probably benign Het
Aox1 T C 1: 58,393,581 (GRCm39) V1247A probably benign Het
Ap4b1 T C 3: 103,727,980 (GRCm39) probably benign Het
Armh3 A T 19: 45,879,679 (GRCm39) M558K probably damaging Het
Atm A G 9: 53,424,480 (GRCm39) V607A probably benign Het
Bltp1 T A 3: 37,041,747 (GRCm39) Y2708* probably null Het
Cass4 C T 2: 172,258,412 (GRCm39) P137S probably damaging Het
Cfap53 A G 18: 74,433,278 (GRCm39) E121G probably damaging Het
Chmp6 T C 11: 119,807,508 (GRCm39) V31A probably damaging Het
Clec4a3 T A 6: 122,944,508 (GRCm39) Y185N probably damaging Het
Clic5 A G 17: 44,586,200 (GRCm39) T230A probably damaging Het
Clspn G T 4: 126,458,796 (GRCm39) probably null Het
Cntn1 T A 15: 92,129,969 (GRCm39) probably benign Het
Col4a3 G A 1: 82,650,474 (GRCm39) G577R unknown Het
Defa21 T A 8: 21,515,784 (GRCm39) probably null Het
Deup1 T C 9: 15,511,117 (GRCm39) R221G possibly damaging Het
Dnah8 A T 17: 30,902,595 (GRCm39) probably benign Het
Dnase1l2 A G 17: 24,660,049 (GRCm39) V273A probably damaging Het
Gm5134 T A 10: 75,829,698 (GRCm39) F328Y probably benign Het
Golph3 A T 15: 12,339,776 (GRCm39) E96D probably damaging Het
Hspd1 A G 1: 55,122,942 (GRCm39) V151A probably benign Het
Htr1f A C 16: 64,746,860 (GRCm39) I144S probably damaging Het
Il23r A G 6: 67,450,772 (GRCm39) probably benign Het
Il25 A G 14: 55,170,553 (GRCm39) E42G probably damaging Het
Il36b A T 2: 24,049,890 (GRCm39) H167L probably benign Het
Klrb1-ps1 C T 6: 129,106,306 (GRCm39) A149V possibly damaging Het
Kmt2e T A 5: 23,690,619 (GRCm39) probably benign Het
Ktn1 A G 14: 47,967,836 (GRCm39) N1167D probably benign Het
Lama4 T A 10: 38,948,734 (GRCm39) D832E probably benign Het
Map1b A G 13: 99,571,846 (GRCm39) S292P probably damaging Het
Map6 C T 7: 98,966,815 (GRCm39) T345I probably damaging Het
Mark2 A T 19: 7,262,017 (GRCm39) probably benign Het
Me3 C A 7: 89,500,967 (GRCm39) H559Q probably benign Het
Myo1b A G 1: 51,817,541 (GRCm39) F574L probably damaging Het
Nr1h5 T A 3: 102,856,889 (GRCm39) K208* probably null Het
Nup214 T C 2: 31,880,379 (GRCm39) probably null Het
Obp2b T C 2: 25,628,645 (GRCm39) L133P probably damaging Het
Or14a259 T C 7: 86,013,395 (GRCm39) D50G possibly damaging Het
Or5k1 A T 16: 58,617,485 (GRCm39) C241* probably null Het
Osbp2 C T 11: 3,667,997 (GRCm39) probably benign Het
Ptafr C A 4: 132,306,864 (GRCm39) L85I probably benign Het
Ptprk T A 10: 28,139,504 (GRCm39) Y76* probably null Het
Rad50 A G 11: 53,545,854 (GRCm39) probably benign Het
Rasef G T 4: 73,681,091 (GRCm39) probably benign Het
Slitrk6 A T 14: 110,987,364 (GRCm39) L781H probably damaging Het
Tbc1d1 T A 5: 64,414,080 (GRCm39) I18N probably damaging Het
Tbc1d17 T C 7: 44,490,832 (GRCm39) N587D probably benign Het
Trank1 A T 9: 111,195,844 (GRCm39) K1289N probably benign Het
Tspyl3 A G 2: 153,066,240 (GRCm39) S333P probably damaging Het
Ush2a G A 1: 188,089,085 (GRCm39) V347I probably benign Het
Usp17le G T 7: 104,418,269 (GRCm39) S291* probably null Het
Usp24 T A 4: 106,225,224 (GRCm39) S619T probably benign Het
Vmn2r10 T C 5: 109,145,467 (GRCm39) probably benign Het
Vmn2r78 A G 7: 86,569,413 (GRCm39) E102G probably benign Het
Vwa3b G A 1: 37,204,770 (GRCm39) V85I possibly damaging Het
Wwp1 A C 4: 19,631,116 (GRCm39) I639R probably damaging Het
Xpo5 A G 17: 46,551,101 (GRCm39) T1001A probably benign Het
Zc3h12c A T 9: 52,055,047 (GRCm39) M235K probably benign Het
Zfp619 G A 7: 39,186,706 (GRCm39) G912D probably damaging Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78,848,278 (GRCm39) missense probably damaging 0.96
IGL01503:Nos2 APN 11 78,836,689 (GRCm39) splice site probably benign
IGL01789:Nos2 APN 11 78,835,483 (GRCm39) splice site probably benign
IGL02797:Nos2 APN 11 78,831,170 (GRCm39) missense probably damaging 1.00
IGL02968:Nos2 APN 11 78,828,463 (GRCm39) missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R0265:Nos2 UTSW 11 78,828,428 (GRCm39) missense probably damaging 0.98
R0441:Nos2 UTSW 11 78,819,409 (GRCm39) missense probably benign 0.10
R0504:Nos2 UTSW 11 78,830,903 (GRCm39) missense probably damaging 1.00
R0570:Nos2 UTSW 11 78,826,187 (GRCm39) missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78,843,629 (GRCm39) missense probably benign 0.00
R1538:Nos2 UTSW 11 78,847,396 (GRCm39) missense probably benign 0.00
R3414:Nos2 UTSW 11 78,848,414 (GRCm39) missense probably benign 0.14
R3418:Nos2 UTSW 11 78,850,521 (GRCm39) missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78,820,602 (GRCm39) missense probably benign 0.01
R4492:Nos2 UTSW 11 78,840,921 (GRCm39) missense probably benign
R4632:Nos2 UTSW 11 78,848,417 (GRCm39) missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78,819,456 (GRCm39) missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78,813,140 (GRCm39) missense probably benign
R5214:Nos2 UTSW 11 78,846,267 (GRCm39) missense probably damaging 1.00
R5377:Nos2 UTSW 11 78,848,317 (GRCm39) missense probably benign 0.00
R5777:Nos2 UTSW 11 78,830,978 (GRCm39) missense probably null 1.00
R5834:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.01
R5930:Nos2 UTSW 11 78,828,741 (GRCm39) missense probably damaging 1.00
R6511:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R6706:Nos2 UTSW 11 78,835,549 (GRCm39) missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78,843,780 (GRCm39) missense probably damaging 0.99
R6762:Nos2 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R6817:Nos2 UTSW 11 78,836,092 (GRCm39) missense possibly damaging 0.64
R6868:Nos2 UTSW 11 78,848,332 (GRCm39) missense probably benign 0.02
R6917:Nos2 UTSW 11 78,842,053 (GRCm39) missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.02
R7286:Nos2 UTSW 11 78,820,680 (GRCm39) missense probably damaging 1.00
R7367:Nos2 UTSW 11 78,840,916 (GRCm39) missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78,827,297 (GRCm39) nonsense probably null
R7411:Nos2 UTSW 11 78,835,681 (GRCm39) critical splice donor site probably null
R7469:Nos2 UTSW 11 78,843,797 (GRCm39) missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78,813,192 (GRCm39) nonsense probably null
R8694:Nos2 UTSW 11 78,836,515 (GRCm39) missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R8872:Nos2 UTSW 11 78,839,949 (GRCm39) missense probably damaging 0.99
R8952:Nos2 UTSW 11 78,836,089 (GRCm39) missense probably benign 0.00
R9433:Nos2 UTSW 11 78,850,490 (GRCm39) missense probably damaging 1.00
R9580:Nos2 UTSW 11 78,828,457 (GRCm39) missense probably benign 0.01
R9612:Nos2 UTSW 11 78,839,984 (GRCm39) missense probably damaging 1.00
R9727:Nos2 UTSW 11 78,843,825 (GRCm39) missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78,822,472 (GRCm39) missense probably damaging 0.96
X0063:Nos2 UTSW 11 78,813,193 (GRCm39) missense probably benign 0.01
Z1177:Nos2 UTSW 11 78,822,498 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTGGTGTTGGCTCCCAGAACTC -3'
(R):5'- TGCAGACAACCTGTGTGACAACC -3'

Sequencing Primer
(F):5'- GTTGGCTCCCAGAACTCTAGAC -3'
(R):5'- CTGTGTGACAACCGTTGAAC -3'
Posted On 2013-04-11