Incidental Mutation 'R1765:Smg1'
ID 194290
Institutional Source Beutler Lab
Gene Symbol Smg1
Ensembl Gene ENSMUSG00000030655
Gene Name SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms 5430435M13Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans), 2610207I05Rik, C130002K18Rik
MMRRC Submission 039797-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1765 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 117730531-117842893 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 117738938 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 3489 (I3489V)
Ref Sequence ENSEMBL: ENSMUSP00000032891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032891]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032891
AA Change: I3489V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032891
Gene: ENSMUSG00000030655
AA Change: I3489V

DomainStartEndE-ValueType
low complexity region 42 55 N/A INTRINSIC
SCOP:d1gw5a_ 147 621 7e-7 SMART
Pfam:SMG1 629 1240 9.8e-249 PFAM
low complexity region 1540 1551 N/A INTRINSIC
SCOP:d1gw5a_ 1680 1942 8e-3 SMART
low complexity region 2125 2141 N/A INTRINSIC
PI3Kc 2149 2493 7.93e-50 SMART
low complexity region 2759 2770 N/A INTRINSIC
low complexity region 3425 3442 N/A INTRINSIC
FATC 3626 3658 8.66e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178025
Predicted Effect probably benign
Transcript: ENSMUST00000179331
SMART Domains Protein: ENSMUSP00000137592
Gene: ENSMUSG00000030655

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
SCOP:d1gw5a_ 71 545 1e-6 SMART
low complexity region 602 612 N/A INTRINSIC
low complexity region 631 646 N/A INTRINSIC
low complexity region 698 718 N/A INTRINSIC
low complexity region 898 915 N/A INTRINSIC
low complexity region 1135 1147 N/A INTRINSIC
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 2049 2065 N/A INTRINSIC
PI3Kc 2073 2417 7.93e-50 SMART
low complexity region 2683 2694 N/A INTRINSIC
low complexity region 3349 3366 N/A INTRINSIC
FATC 3550 3582 8.66e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207162
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in nonsense-mediated mRNA decay (NMD) as part of the mRNA surveillance complex. The protein has kinase activity and is thought to function in NMD by phosphorylating the regulator of nonsense transcripts 1 protein. Alternatively spliced transcript variants have been described, but their full-length nature has yet to be determined. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early embryonic lethality. Mice heteroygous for a gene trap allele exhibit abnormal tooth development, chronic inflammation, increased body weight, increased incidence of tumor formation and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933412E24Rik G T 15: 59,887,194 (GRCm39) C415* probably null Het
Adamtsl2 A C 2: 26,992,842 (GRCm39) I652L probably benign Het
Adgrl4 T C 3: 151,248,872 (GRCm39) I720T probably damaging Het
Agrn A T 4: 156,261,284 (GRCm39) C604* probably null Het
Amh AGCGCCTTGG AG 10: 80,641,419 (GRCm39) probably null Het
B3galt2 C A 1: 143,522,207 (GRCm39) N114K probably benign Het
Bud23 A T 5: 135,084,897 (GRCm39) M59K probably benign Het
C3 C T 17: 57,531,401 (GRCm39) probably null Het
C9orf72 A C 4: 35,197,098 (GRCm39) H322Q probably damaging Het
Cc2d2a A T 5: 43,871,873 (GRCm39) D903V probably damaging Het
Ccdc9b G A 2: 118,591,128 (GRCm39) A135V probably benign Het
Cd84 A G 1: 171,700,317 (GRCm39) T145A possibly damaging Het
Cdan1 A C 2: 120,551,230 (GRCm39) L1097V probably damaging Het
Cdc26 T A 4: 62,313,155 (GRCm39) N62I probably benign Het
Cdc27 G T 11: 104,425,607 (GRCm39) Q70K probably damaging Het
Cenpq A T 17: 41,235,178 (GRCm39) probably null Het
Cep295 T C 9: 15,239,200 (GRCm39) S1858G probably damaging Het
Clasp1 T C 1: 118,433,261 (GRCm39) S247P probably damaging Het
Cyp2w1 C T 5: 139,339,623 (GRCm39) T71I probably damaging Het
Dcaf1 T C 9: 106,741,793 (GRCm39) F1336S probably damaging Het
Dennd6b G A 15: 89,074,506 (GRCm39) Q104* probably null Het
Dglucy T A 12: 100,816,361 (GRCm39) probably null Het
Dnajc9 A G 14: 20,438,158 (GRCm39) V148A possibly damaging Het
Dnmbp T A 19: 43,890,579 (GRCm39) D396V possibly damaging Het
Dock10 T A 1: 80,583,540 (GRCm39) I221F probably damaging Het
Dscam T C 16: 96,486,579 (GRCm39) N1032S probably benign Het
Dsg4 A C 18: 20,589,888 (GRCm39) Y346S probably benign Het
Dync1i2 A G 2: 71,079,759 (GRCm39) H417R probably benign Het
Dysf G A 6: 84,167,884 (GRCm39) probably null Het
Elovl1 A G 4: 118,287,707 (GRCm39) M1V probably null Het
Eva1c A G 16: 90,701,135 (GRCm39) S257G probably benign Het
Eya2 A T 2: 165,566,723 (GRCm39) D258V probably damaging Het
Fam193a A G 5: 34,593,841 (GRCm39) T113A probably damaging Het
Fbxw15 G A 9: 109,387,314 (GRCm39) S227F probably damaging Het
Fstl5 G T 3: 76,500,783 (GRCm39) R404L possibly damaging Het
Glud1 T C 14: 34,047,541 (GRCm39) probably benign Het
Gm10770 A C 2: 150,021,258 (GRCm39) H86Q probably damaging Het
Gzme C T 14: 56,355,871 (GRCm39) G147D probably damaging Het
Herc3 T C 6: 58,865,645 (GRCm39) V746A probably damaging Het
Hmga1 A G 17: 27,778,592 (GRCm39) E17G probably damaging Het
Kdelr2 A T 5: 143,406,567 (GRCm39) K206* probably null Het
Kng2 A G 16: 22,806,993 (GRCm39) probably null Het
Lrrc41 G A 4: 115,946,248 (GRCm39) R321H possibly damaging Het
Mapkapk2 A T 1: 130,986,498 (GRCm39) M1K probably null Het
Me2 A G 18: 73,924,929 (GRCm39) F263L probably damaging Het
Mkks A G 2: 136,722,287 (GRCm39) L290P probably damaging Het
Mmp12 T A 9: 7,354,772 (GRCm39) I255N probably damaging Het
Mogs A G 6: 83,093,784 (GRCm39) D251G probably benign Het
Morf4l1 T A 9: 89,984,401 (GRCm39) Y65F possibly damaging Het
Neb T C 2: 52,094,676 (GRCm39) D5169G probably damaging Het
Nin A G 12: 70,089,665 (GRCm39) L1250P probably damaging Het
Nomo1 G T 7: 45,715,717 (GRCm39) G721V possibly damaging Het
Notch2 T G 3: 98,029,242 (GRCm39) C1002G probably damaging Het
Npat T C 9: 53,481,522 (GRCm39) Y1077H probably benign Het
Or1e1c T A 11: 73,266,170 (GRCm39) N198K probably damaging Het
Or4g17 G A 2: 111,209,491 (GRCm39) V49I probably benign Het
Or4p21 A T 2: 88,276,367 (GRCm39) F305Y probably damaging Het
Or5h25 A G 16: 58,930,118 (GRCm39) L285P probably damaging Het
Or8c16 T C 9: 38,130,548 (GRCm39) I143T probably benign Het
Otop2 A T 11: 115,215,504 (GRCm39) I142F probably benign Het
Pacsin3 A G 2: 91,093,460 (GRCm39) E279G possibly damaging Het
Pafah2 A G 4: 134,140,758 (GRCm39) T243A probably benign Het
Pcdhgc5 A G 18: 37,954,913 (GRCm39) H729R probably benign Het
Plcd1 T C 9: 118,900,874 (GRCm39) D756G probably damaging Het
Prune2 A G 19: 17,102,962 (GRCm39) E2707G probably damaging Het
Rit2 C T 18: 31,449,951 (GRCm39) G16S probably damaging Het
Sec24c A G 14: 20,738,922 (GRCm39) probably benign Het
Skint5 G T 4: 113,434,858 (GRCm39) T1037K unknown Het
Slc28a2 T A 2: 122,290,876 (GRCm39) probably null Het
Slc41a2 G A 10: 83,137,130 (GRCm39) A259V probably damaging Het
Slc6a17 T A 3: 107,380,895 (GRCm39) I537F possibly damaging Het
Slco1a7 T C 6: 141,700,084 (GRCm39) probably benign Het
Smchd1 A T 17: 71,707,196 (GRCm39) probably benign Het
Sytl3 T C 17: 6,967,082 (GRCm39) L142P probably damaging Het
Tektl1 A T 10: 78,584,502 (GRCm39) M340K probably benign Het
Tfr2 C T 5: 137,581,707 (GRCm39) T598I probably damaging Het
Tmc2 A G 2: 130,102,145 (GRCm39) Q770R probably benign Het
Tnc C T 4: 63,932,231 (GRCm39) V728M probably damaging Het
Trim68 A T 7: 102,329,597 (GRCm39) M177K possibly damaging Het
Trmt11 T C 10: 30,435,184 (GRCm39) D325G probably benign Het
Ube3a C T 7: 58,935,862 (GRCm39) T582I probably damaging Het
Usp13 G A 3: 32,969,919 (GRCm39) E682K probably benign Het
Usp9y A G Y: 1,384,454 (GRCm39) V688A possibly damaging Het
Uts2r A G 11: 121,052,095 (GRCm39) T320A possibly damaging Het
Vmn1r34 A T 6: 66,614,480 (GRCm39) M86K probably damaging Het
Vsig10 A G 5: 117,456,880 (GRCm39) probably benign Het
Zbtb41 T A 1: 139,368,132 (GRCm39) C607S probably benign Het
Other mutations in Smg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Smg1 APN 7 117,797,494 (GRCm39) utr 3 prime probably benign
IGL00481:Smg1 APN 7 117,810,017 (GRCm39) missense possibly damaging 0.67
IGL00503:Smg1 APN 7 117,784,706 (GRCm39) utr 3 prime probably benign
IGL00927:Smg1 APN 7 117,739,855 (GRCm39) missense probably damaging 1.00
IGL01333:Smg1 APN 7 117,762,601 (GRCm39) splice site probably benign
IGL01344:Smg1 APN 7 117,790,059 (GRCm39) utr 3 prime probably benign
IGL01397:Smg1 APN 7 117,762,444 (GRCm39) utr 3 prime probably benign
IGL01403:Smg1 APN 7 117,757,355 (GRCm39) utr 3 prime probably benign
IGL01573:Smg1 APN 7 117,767,185 (GRCm39) utr 3 prime probably benign
IGL01872:Smg1 APN 7 117,748,167 (GRCm39) utr 3 prime probably benign
IGL02010:Smg1 APN 7 117,785,369 (GRCm39) utr 3 prime probably benign
IGL02158:Smg1 APN 7 117,812,169 (GRCm39) missense possibly damaging 0.77
IGL02268:Smg1 APN 7 117,781,764 (GRCm39) missense probably benign 0.19
IGL02314:Smg1 APN 7 117,753,932 (GRCm39) utr 3 prime probably benign
IGL02552:Smg1 APN 7 117,795,117 (GRCm39) utr 3 prime probably benign
IGL02577:Smg1 APN 7 117,802,345 (GRCm39) missense probably damaging 0.99
IGL02859:Smg1 APN 7 117,748,156 (GRCm39) utr 3 prime probably benign
IGL02890:Smg1 APN 7 117,784,724 (GRCm39) utr 3 prime probably benign
IGL02892:Smg1 APN 7 117,767,178 (GRCm39) utr 3 prime probably benign
IGL03119:Smg1 APN 7 117,794,336 (GRCm39) utr 3 prime probably benign
IGL03123:Smg1 APN 7 117,756,404 (GRCm39) utr 3 prime probably benign
IGL03128:Smg1 APN 7 117,802,282 (GRCm39) missense probably benign 0.03
IGL03184:Smg1 APN 7 117,779,603 (GRCm39) missense possibly damaging 0.86
PIT4508001:Smg1 UTSW 7 117,784,764 (GRCm39) missense unknown
R0010:Smg1 UTSW 7 117,771,082 (GRCm39) utr 3 prime probably benign
R0010:Smg1 UTSW 7 117,771,082 (GRCm39) utr 3 prime probably benign
R0025:Smg1 UTSW 7 117,811,666 (GRCm39) missense possibly damaging 0.92
R0025:Smg1 UTSW 7 117,811,666 (GRCm39) missense possibly damaging 0.92
R0098:Smg1 UTSW 7 117,744,690 (GRCm39) missense probably benign 0.02
R0139:Smg1 UTSW 7 117,751,898 (GRCm39) critical splice donor site probably null
R0371:Smg1 UTSW 7 117,767,523 (GRCm39) utr 3 prime probably benign
R0415:Smg1 UTSW 7 117,781,691 (GRCm39) missense probably benign 0.34
R0416:Smg1 UTSW 7 117,783,684 (GRCm39) splice site probably benign
R0423:Smg1 UTSW 7 117,776,103 (GRCm39) missense possibly damaging 0.53
R0600:Smg1 UTSW 7 117,759,606 (GRCm39) utr 3 prime probably benign
R0626:Smg1 UTSW 7 117,781,606 (GRCm39) missense possibly damaging 0.82
R0627:Smg1 UTSW 7 117,767,084 (GRCm39) utr 3 prime probably benign
R0727:Smg1 UTSW 7 117,765,645 (GRCm39) utr 3 prime probably benign
R0729:Smg1 UTSW 7 117,745,512 (GRCm39) utr 3 prime probably benign
R0841:Smg1 UTSW 7 117,742,524 (GRCm39) missense possibly damaging 0.96
R1114:Smg1 UTSW 7 117,759,013 (GRCm39) utr 3 prime probably benign
R1256:Smg1 UTSW 7 117,802,310 (GRCm39) missense probably damaging 1.00
R1298:Smg1 UTSW 7 117,767,434 (GRCm39) utr 3 prime probably benign
R1370:Smg1 UTSW 7 117,758,975 (GRCm39) utr 3 prime probably benign
R1591:Smg1 UTSW 7 117,756,142 (GRCm39) utr 3 prime probably benign
R1736:Smg1 UTSW 7 117,765,190 (GRCm39) splice site probably null
R1755:Smg1 UTSW 7 117,802,287 (GRCm39) nonsense probably null
R1789:Smg1 UTSW 7 117,745,021 (GRCm39) missense possibly damaging 0.73
R1845:Smg1 UTSW 7 117,753,845 (GRCm39) utr 3 prime probably benign
R1908:Smg1 UTSW 7 117,753,422 (GRCm39) utr 3 prime probably benign
R1909:Smg1 UTSW 7 117,753,422 (GRCm39) utr 3 prime probably benign
R1942:Smg1 UTSW 7 117,757,326 (GRCm39) utr 3 prime probably benign
R2064:Smg1 UTSW 7 117,756,090 (GRCm39) utr 3 prime probably benign
R2072:Smg1 UTSW 7 117,762,389 (GRCm39) utr 3 prime probably benign
R2154:Smg1 UTSW 7 117,757,299 (GRCm39) utr 3 prime probably benign
R2895:Smg1 UTSW 7 117,788,366 (GRCm39) utr 3 prime probably benign
R2915:Smg1 UTSW 7 117,810,102 (GRCm39) splice site probably benign
R3416:Smg1 UTSW 7 117,748,076 (GRCm39) utr 3 prime probably benign
R3417:Smg1 UTSW 7 117,748,076 (GRCm39) utr 3 prime probably benign
R3873:Smg1 UTSW 7 117,753,885 (GRCm39) utr 3 prime probably benign
R4082:Smg1 UTSW 7 117,759,469 (GRCm39) utr 3 prime probably benign
R4230:Smg1 UTSW 7 117,747,956 (GRCm39) critical splice donor site probably null
R4304:Smg1 UTSW 7 117,738,741 (GRCm39) missense probably benign 0.03
R4549:Smg1 UTSW 7 117,758,906 (GRCm39) utr 3 prime probably benign
R4571:Smg1 UTSW 7 117,738,688 (GRCm39) missense possibly damaging 0.72
R4638:Smg1 UTSW 7 117,795,149 (GRCm39) utr 3 prime probably benign
R4642:Smg1 UTSW 7 117,753,487 (GRCm39) utr 3 prime probably benign
R4656:Smg1 UTSW 7 117,812,174 (GRCm39) missense probably benign 0.00
R4754:Smg1 UTSW 7 117,755,954 (GRCm39) utr 3 prime probably benign
R4798:Smg1 UTSW 7 117,779,697 (GRCm39) missense probably benign 0.32
R4906:Smg1 UTSW 7 117,751,631 (GRCm39) utr 3 prime probably benign
R4978:Smg1 UTSW 7 117,753,470 (GRCm39) utr 3 prime probably benign
R4989:Smg1 UTSW 7 117,807,274 (GRCm39) missense probably benign
R4989:Smg1 UTSW 7 117,757,323 (GRCm39) utr 3 prime probably benign
R5026:Smg1 UTSW 7 117,792,768 (GRCm39) utr 3 prime probably benign
R5124:Smg1 UTSW 7 117,812,235 (GRCm39) missense probably benign 0.00
R5318:Smg1 UTSW 7 117,759,427 (GRCm39) utr 3 prime probably benign
R5356:Smg1 UTSW 7 117,794,356 (GRCm39) utr 3 prime probably benign
R5404:Smg1 UTSW 7 117,806,131 (GRCm39) missense probably damaging 1.00
R5423:Smg1 UTSW 7 117,745,294 (GRCm39) missense possibly damaging 0.70
R5441:Smg1 UTSW 7 117,794,304 (GRCm39) utr 3 prime probably benign
R5490:Smg1 UTSW 7 117,738,659 (GRCm39) missense possibly damaging 0.86
R5541:Smg1 UTSW 7 117,756,386 (GRCm39) utr 3 prime probably benign
R5564:Smg1 UTSW 7 117,789,042 (GRCm39) utr 3 prime probably benign
R5580:Smg1 UTSW 7 117,748,125 (GRCm39) utr 3 prime probably benign
R5600:Smg1 UTSW 7 117,767,107 (GRCm39) utr 3 prime probably benign
R5628:Smg1 UTSW 7 117,753,924 (GRCm39) utr 3 prime probably benign
R5646:Smg1 UTSW 7 117,811,782 (GRCm39) missense probably benign 0.42
R5656:Smg1 UTSW 7 117,753,887 (GRCm39) utr 3 prime probably benign
R5660:Smg1 UTSW 7 117,742,570 (GRCm39) missense probably benign 0.33
R5706:Smg1 UTSW 7 117,744,813 (GRCm39) missense possibly damaging 0.86
R5786:Smg1 UTSW 7 117,812,120 (GRCm39) missense probably benign 0.12
R5890:Smg1 UTSW 7 117,789,809 (GRCm39) utr 3 prime probably benign
R5912:Smg1 UTSW 7 117,753,809 (GRCm39) utr 3 prime probably benign
R5977:Smg1 UTSW 7 117,740,580 (GRCm39) utr 3 prime probably benign
R5993:Smg1 UTSW 7 117,739,732 (GRCm39) missense probably benign 0.33
R6161:Smg1 UTSW 7 117,762,553 (GRCm39) utr 3 prime probably benign
R6187:Smg1 UTSW 7 117,788,386 (GRCm39) utr 3 prime probably benign
R6264:Smg1 UTSW 7 117,765,310 (GRCm39) utr 3 prime probably benign
R6331:Smg1 UTSW 7 117,753,500 (GRCm39) utr 3 prime probably benign
R6561:Smg1 UTSW 7 117,765,300 (GRCm39) utr 3 prime probably benign
R6571:Smg1 UTSW 7 117,783,737 (GRCm39) utr 3 prime probably benign
R6736:Smg1 UTSW 7 117,756,389 (GRCm39) utr 3 prime probably benign
R6752:Smg1 UTSW 7 117,762,539 (GRCm39) utr 3 prime probably benign
R6777:Smg1 UTSW 7 117,788,340 (GRCm39) utr 3 prime probably benign
R6788:Smg1 UTSW 7 117,783,794 (GRCm39) utr 3 prime probably benign
R6883:Smg1 UTSW 7 117,767,403 (GRCm39) utr 3 prime probably benign
R6991:Smg1 UTSW 7 117,767,091 (GRCm39) utr 3 prime probably benign
R7056:Smg1 UTSW 7 117,745,623 (GRCm39) splice site probably benign
R7058:Smg1 UTSW 7 117,797,502 (GRCm39) utr 3 prime probably benign
R7100:Smg1 UTSW 7 117,783,743 (GRCm39) missense unknown
R7133:Smg1 UTSW 7 117,752,131 (GRCm39) missense unknown
R7221:Smg1 UTSW 7 117,782,020 (GRCm39) missense possibly damaging 0.86
R7229:Smg1 UTSW 7 117,776,178 (GRCm39) missense probably benign 0.03
R7293:Smg1 UTSW 7 117,765,322 (GRCm39) missense unknown
R7361:Smg1 UTSW 7 117,784,200 (GRCm39) missense unknown
R7438:Smg1 UTSW 7 117,795,116 (GRCm39) missense unknown
R7686:Smg1 UTSW 7 117,767,081 (GRCm39) missense unknown
R7798:Smg1 UTSW 7 117,771,162 (GRCm39) missense possibly damaging 0.73
R7908:Smg1 UTSW 7 117,785,357 (GRCm39) missense unknown
R7923:Smg1 UTSW 7 117,742,545 (GRCm39) missense possibly damaging 0.96
R7978:Smg1 UTSW 7 117,792,878 (GRCm39) missense unknown
R7997:Smg1 UTSW 7 117,772,365 (GRCm39) missense unknown
R7997:Smg1 UTSW 7 117,772,364 (GRCm39) missense unknown
R8025:Smg1 UTSW 7 117,806,212 (GRCm39) nonsense probably null
R8056:Smg1 UTSW 7 117,759,589 (GRCm39) missense unknown
R8061:Smg1 UTSW 7 117,751,610 (GRCm39) missense unknown
R8095:Smg1 UTSW 7 117,772,285 (GRCm39) missense unknown
R8198:Smg1 UTSW 7 117,744,829 (GRCm39) missense probably benign 0.03
R8399:Smg1 UTSW 7 117,789,794 (GRCm39) missense unknown
R8445:Smg1 UTSW 7 117,736,200 (GRCm39) missense possibly damaging 0.72
R8519:Smg1 UTSW 7 117,770,982 (GRCm39) utr 3 prime probably benign
R8817:Smg1 UTSW 7 117,758,887 (GRCm39) missense unknown
R8832:Smg1 UTSW 7 117,739,006 (GRCm39) missense probably benign 0.33
R8855:Smg1 UTSW 7 117,806,122 (GRCm39) missense unknown
R8866:Smg1 UTSW 7 117,806,122 (GRCm39) missense unknown
R8946:Smg1 UTSW 7 117,751,900 (GRCm39) missense probably null
R8954:Smg1 UTSW 7 117,806,215 (GRCm39) missense probably damaging 1.00
R8967:Smg1 UTSW 7 117,765,739 (GRCm39) missense unknown
R9072:Smg1 UTSW 7 117,783,032 (GRCm39) missense unknown
R9090:Smg1 UTSW 7 117,811,786 (GRCm39) missense unknown
R9156:Smg1 UTSW 7 117,753,884 (GRCm39) missense unknown
R9198:Smg1 UTSW 7 117,795,179 (GRCm39) missense unknown
R9240:Smg1 UTSW 7 117,739,031 (GRCm39) missense probably benign 0.18
R9271:Smg1 UTSW 7 117,811,786 (GRCm39) missense unknown
R9289:Smg1 UTSW 7 117,744,639 (GRCm39) missense possibly damaging 0.53
R9378:Smg1 UTSW 7 117,777,998 (GRCm39) nonsense probably null
R9396:Smg1 UTSW 7 117,807,303 (GRCm39) missense unknown
R9469:Smg1 UTSW 7 117,739,774 (GRCm39) missense possibly damaging 0.72
R9539:Smg1 UTSW 7 117,744,976 (GRCm39) missense probably benign 0.03
R9549:Smg1 UTSW 7 117,795,254 (GRCm39) missense unknown
R9563:Smg1 UTSW 7 117,812,208 (GRCm39) missense unknown
R9564:Smg1 UTSW 7 117,812,208 (GRCm39) missense unknown
R9597:Smg1 UTSW 7 117,812,270 (GRCm39) missense unknown
R9643:Smg1 UTSW 7 117,755,933 (GRCm39) missense unknown
R9703:Smg1 UTSW 7 117,739,744 (GRCm39) missense possibly damaging 0.73
R9730:Smg1 UTSW 7 117,783,004 (GRCm39) missense unknown
Z1088:Smg1 UTSW 7 117,777,622 (GRCm39) missense possibly damaging 0.96
Z1088:Smg1 UTSW 7 117,767,884 (GRCm39) nonsense probably null
Z1088:Smg1 UTSW 7 117,753,858 (GRCm39) utr 3 prime probably benign
Z1176:Smg1 UTSW 7 117,806,130 (GRCm39) missense unknown
Z1176:Smg1 UTSW 7 117,806,110 (GRCm39) missense unknown
Z1177:Smg1 UTSW 7 117,812,256 (GRCm39) missense unknown
Z1177:Smg1 UTSW 7 117,767,831 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- GGACTTGAACATTCATTTGCTGCATCG -3'
(R):5'- TCAGTGGGCTACAACAGTCATTTTGG -3'

Sequencing Primer
(F):5'- TGACTAGGGGTGATGCAAAAC -3'
(R):5'- GCTTTTAATCAAGGGGTAACTGTC -3'
Posted On 2014-05-23