Mutagenetix > Incidental Mutation

Incidental Mutation 'R0035:Map1b'

19430

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

MMRRC Submission

038329-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0035 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 99435338 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 292 (S292P)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762] [ENSMUST00000223725]

AlphaFold

P14873

Predicted Effect

probably damaging
Transcript: ENSMUST00000064762
AA Change: S292P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: S292P

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

probably benign
Transcript: ENSMUST00000223725

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Meta Mutation Damage Score

0.8116

Coding Region Coverage

1x: 99.1%
3x: 97.8%
10x: 94.7%
20x: 87.1%

Validation Efficiency

99% (70/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110040N11Rik	T	C	7: 81,788,549	T20A	probably benign	Het
4932438A13Rik	T	A	3: 36,987,598	Y2708*	probably null	Het
9130011E15Rik	A	T	19: 45,891,240	M558K	probably damaging	Het
Aadacl4	A	G	4: 144,617,941	T96A	probably damaging	Het
Abcb6	A	G	1: 75,175,007	V473A	possibly damaging	Het
Abo	C	A	2: 26,843,373	K273N	possibly damaging	Het
Acvr1c	A	G	2: 58,315,779		probably benign	Het
Adcy8	A	T	15: 64,699,368	V1142D	probably benign	Het
Akna	T	A	4: 63,382,445	H591L	probably benign	Het
Aox2	T	C	1: 58,354,422	V1247A	probably benign	Het
Ap4b1	T	C	3: 103,820,664		probably benign	Het
Atm	A	G	9: 53,513,180	V607A	probably benign	Het
Cass4	C	T	2: 172,416,492	P137S	probably damaging	Het
Cfap53	A	G	18: 74,300,207	E121G	probably damaging	Het
Chmp6	T	C	11: 119,916,682	V31A	probably damaging	Het
Clec4a3	T	A	6: 122,967,549	Y185N	probably damaging	Het
Clic5	A	G	17: 44,275,313	T230A	probably damaging	Het
Clspn	G	T	4: 126,565,003		probably null	Het
Cntn1	T	A	15: 92,232,088		probably benign	Het
Col4a3	G	A	1: 82,672,753	G577R	unknown	Het
Defa21	T	A	8: 21,025,768		probably null	Het
Deup1	T	C	9: 15,599,821	R221G	possibly damaging	Het
Dnah8	A	T	17: 30,683,621		probably benign	Het
Dnase1l2	A	G	17: 24,441,075	V273A	probably damaging	Het
Gm5134	T	A	10: 75,993,864	F328Y	probably benign	Het
Golph3	A	T	15: 12,339,690	E96D	probably damaging	Het
Hspd1	A	G	1: 55,083,783	V151A	probably benign	Het
Htr1f	A	C	16: 64,926,497	I144S	probably damaging	Het
Il1f8	A	T	2: 24,159,878	H167L	probably benign	Het
Il23r	A	G	6: 67,473,788		probably benign	Het
Il25	A	G	14: 54,933,096	E42G	probably damaging	Het
Klrb1-ps1	C	T	6: 129,129,343	A149V	possibly damaging	Het
Kmt2e	T	A	5: 23,485,621		probably benign	Het
Ktn1	A	G	14: 47,730,379	N1167D	probably benign	Het
Lama4	T	A	10: 39,072,738	D832E	probably benign	Het
Map6	C	T	7: 99,317,608	T345I	probably damaging	Het
Mark2	A	T	19: 7,284,652		probably benign	Het
Me3	C	A	7: 89,851,759	H559Q	probably benign	Het
Myo1b	A	G	1: 51,778,382	F574L	probably damaging	Het
Nos2	T	C	11: 78,945,727	S431P	probably damaging	Het
Nr1h5	T	A	3: 102,949,573	K208*	probably null	Het
Nup214	T	C	2: 31,990,367		probably null	Het
Obp2b	T	C	2: 25,738,633	L133P	probably damaging	Het
Olfr173	A	T	16: 58,797,122	C241*	probably null	Het
Olfr305	T	C	7: 86,364,187	D50G	possibly damaging	Het
Osbp2	C	T	11: 3,717,997		probably benign	Het
Ptafr	C	A	4: 132,579,553	L85I	probably benign	Het
Ptprk	T	A	10: 28,263,508	Y76*	probably null	Het
Rad50	A	G	11: 53,655,027		probably benign	Het
Rasef	G	T	4: 73,762,854		probably benign	Het
Slitrk6	A	T	14: 110,749,932	L781H	probably damaging	Het
Tbc1d1	T	A	5: 64,256,737	I18N	probably damaging	Het
Tbc1d17	T	C	7: 44,841,408	N587D	probably benign	Het
Trank1	A	T	9: 111,366,776	K1289N	probably benign	Het
Tspyl3	A	G	2: 153,224,320	S333P	probably damaging	Het
Ush2a	G	A	1: 188,356,888	V347I	probably benign	Het
Usp17le	G	T	7: 104,769,062	S291*	probably null	Het
Usp24	T	A	4: 106,368,027	S619T	probably benign	Het
Vmn2r10	T	C	5: 108,997,601		probably benign	Het
Vmn2r78	A	G	7: 86,920,205	E102G	probably benign	Het
Vwa3b	G	A	1: 37,165,689	V85I	possibly damaging	Het
Wwp1	A	C	4: 19,631,116	I639R	probably damaging	Het
Xpo5	A	G	17: 46,240,175	T1001A	probably benign	Het
Zc3h12c	A	T	9: 52,143,747	M235K	probably benign	Het
Zfp619	G	A	7: 39,537,282	G912D	probably damaging	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6063:Map1b	UTSW	13	99431137	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TCAGGTACGTTGAGAAACACAACCC -3'
(R):5'- GGTGACATCACTGACACTTTCCCC -3'

Sequencing Primer
(F):5'- AGGGGAGATGAGGTTTTTCATCC -3'
(R):5'- CAGCTTCTATCTTGCCAGAAATGG -3'

Posted On

2013-04-11