Mutagenetix > Incidental Mutation

Incidental Mutation 'R1766:Ptgfrn'

194345

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

039798-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1766 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 101050122 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 712 (I712N)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

AlphaFold

Q9WV91

Predicted Effect

probably benign
Transcript: ENSMUST00000102694
AA Change: I712N

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: I712N

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933403O08Rik	T	C	X: 112,241,085	Y22H	probably benign	Het
Afg1l	T	C	10: 42,454,495	T59A	probably benign	Het
Ankrd17	T	A	5: 90,264,797	M1223L	possibly damaging	Het
Ankrd24	G	A	10: 81,638,638	S68N	probably benign	Het
Arhgap31	A	G	16: 38,625,590	I131T	probably damaging	Het
Arhgef10	A	T	8: 14,979,836	I874F	probably damaging	Het
Arl5b	T	C	2: 15,069,837	V43A	probably benign	Het
BC051665	G	A	13: 60,785,040	H36Y	probably benign	Het
Cdh9	A	G	15: 16,778,306	D69G	probably damaging	Het
Chd6	G	A	2: 160,966,639	L1552F	probably damaging	Het
Chrd	A	G	16: 20,737,441	H584R	probably damaging	Het
Dnhd1	G	A	7: 105,693,972	V1508I	possibly damaging	Het
Dpy19l4	C	T	4: 11,303,360	G187D	probably damaging	Het
Dync2h1	T	C	9: 7,015,526		probably null	Het
Ehbp1l1	A	G	19: 5,716,406	V1303A	probably damaging	Het
Eif4e1b	G	A	13: 54,786,891	E182K	probably damaging	Het
Fam170b	A	T	14: 32,835,886	Q226L	possibly damaging	Het
Fam193a	C	T	5: 34,462,131	P760L	probably damaging	Het
Gabra5	A	T	7: 57,508,048	L6H	probably benign	Het
Gabrq	G	A	X: 72,833,383	R161H	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm7334	T	A	17: 50,698,978	D97E	probably damaging	Het
Gpsm1	G	A	2: 26,325,383	A286T	probably damaging	Het
Gsta4	C	A	9: 78,204,329	Y79*	probably null	Het
Hcn1	T	A	13: 117,656,734	V174D	probably benign	Het
Hic1	G	T	11: 75,165,794	C756*	probably null	Het
Hivep3	C	T	4: 120,096,671	T728I	probably benign	Het
Ice1	T	C	13: 70,604,442	E1175G	possibly damaging	Het
Igsf3	T	A	3: 101,431,282	L304Q	probably damaging	Het
Kpna6	T	C	4: 129,657,442	D90G	probably benign	Het
Krt73	C	T	15: 101,793,928	G500D	probably damaging	Het
Lama3	A	G	18: 12,402,062	K156E	probably damaging	Het
Mdm2	T	C	10: 117,696,022	K94E	probably damaging	Het
Mitf	T	C	6: 97,941,099	S26P	probably damaging	Het
Myh4	C	A	11: 67,256,295	Q1589K	possibly damaging	Het
Nlrp4c	T	A	7: 6,073,114	V671E	probably benign	Het
Nop9	C	T	14: 55,752,134	A407V	possibly damaging	Het
Nrap	T	A	19: 56,335,042	H1366L	probably damaging	Het
Ntrk1	A	T	3: 87,778,518	C766S	probably damaging	Het
Olfr625-ps1	A	G	7: 103,682,861	N38D	possibly damaging	Het
Olfr735	T	C	14: 50,346,220	Y43C	probably damaging	Het
Olfr768	T	C	10: 129,093,747	I76V	probably benign	Het
Olfr845	A	G	9: 19,338,858	T133A	probably benign	Het
Oog3	C	T	4: 144,159,122	G302D	possibly damaging	Het
Pdzph1	C	T	17: 58,973,752	V512I	probably benign	Het
Phf2	A	C	13: 48,819,557	S408A	unknown	Het
Pigk	T	G	3: 152,740,156	L135V	probably damaging	Het
Ppp2ca	C	A	11: 52,121,946	T301N	probably benign	Het
Ppp4r3a	A	G	12: 101,058,482	S253P	probably damaging	Het
Rapgef2	A	T	3: 79,092,703	D579E	probably damaging	Het
Rims2	T	A	15: 39,462,580	D769E	probably damaging	Het
Rptor	T	A	11: 119,725,061	C134S	probably damaging	Het
S100a1	A	G	3: 90,511,292	F72L	probably damaging	Het
Scube1	T	A	15: 83,721,945	D42V	probably damaging	Het
Sh3glb1	T	C	3: 144,712,685	D39G	probably damaging	Het
Sh3pxd2a	T	C	19: 47,273,250	T397A	probably benign	Het
Siglece	G	A	7: 43,651,532	T453M	probably damaging	Het
Slc26a1	G	A	5: 108,671,792	R514W	probably damaging	Het
Slc4a8	T	C	15: 100,787,212	V156A	probably benign	Het
Smchd1	A	T	17: 71,391,379	V1134E	probably damaging	Het
Sorbs2	A	G	8: 45,770,576	Y222C	probably damaging	Het
Sorcs3	G	T	19: 48,603,875	W326C	possibly damaging	Het
Taf2	A	G	15: 55,071,397	V45A	probably benign	Het
Tiparp	A	T	3: 65,532,049	H80L	probably damaging	Het
Tmem71	T	A	15: 66,541,699	T175S	probably benign	Het
Tmem87b	T	A	2: 128,839,170	V338D	probably damaging	Het
Trdn	A	G	10: 33,364,008	K445R	probably damaging	Het
Trim14	A	G	4: 46,522,039	F213L	probably benign	Het
Tubgcp5	T	A	7: 55,815,020	S550T	probably benign	Het
Tufm	A	G	7: 126,490,472	D446G	probably benign	Het
Vipr1	A	T	9: 121,661,419	Y177F	possibly damaging	Het
Vmn2r116	A	C	17: 23,401,766	I825L	probably damaging	Het
Vmn2r12	G	T	5: 109,092,044	Q218K	probably damaging	Het
Vwa7	G	T	17: 35,023,943		probably null	Het
Ywhae	T	C	11: 75,755,665	V119A	probably damaging	Het
Zfand5	A	G	19: 21,280,524	R199G	probably damaging	Het
Zfp810	T	C	9: 22,278,532	Y360C	possibly damaging	Het
Zrsr1	A	G	11: 22,973,637	D137G	probably benign	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1540:Ptgfrn	UTSW	3	101060654	missense	probably benign	0.41
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2113:Ptgfrn	UTSW	3	101077309	missense	probably benign	0.00
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5927:Ptgfrn	UTSW	3	101060652	missense	possibly damaging	0.92
R5984:Ptgfrn	UTSW	3	101050143	missense	probably damaging	0.99
R6124:Ptgfrn	UTSW	3	101073089	missense	probably damaging	0.98
R6331:Ptgfrn	UTSW	3	101045620	missense	possibly damaging	0.64
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6473:Ptgfrn	UTSW	3	101045639	missense	probably damaging	1.00
R6856:Ptgfrn	UTSW	3	101045446	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7823:Ptgfrn	UTSW	3	101043409	missense	probably damaging	1.00
R7841:Ptgfrn	UTSW	3	101060810	missense	probably damaging	0.98
R8093:Ptgfrn	UTSW	3	101056437	missense	probably benign	0.19
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
R8856:Ptgfrn	UTSW	3	101056611	missense	possibly damaging	0.86
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCAAGCCAGCAATGAGTCAG -3'
(R):5'- CGATTCCCAGAAAAGAGAGCCACATTT -3'

Sequencing Primer
(F):5'- tgagcaagccatagggaac -3'
(R):5'- TACTGTCTTCCAGGTCCCACAT -3'

Posted On

2014-05-23