Incidental Mutation 'R0035:Cntn1'
ID19436
Institutional Source Beutler Lab
Gene Symbol Cntn1
Ensembl Gene ENSMUSG00000055022
Gene Namecontactin 1
SynonymsCNTN, F3cam
MMRRC Submission 038329-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0035 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location92051165-92341967 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 92232088 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000109] [ENSMUST00000068378] [ENSMUST00000169825]
Predicted Effect probably benign
Transcript: ENSMUST00000000109
SMART Domains Protein: ENSMUSP00000000109
Gene: ENSMUSG00000055022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068378
SMART Domains Protein: ENSMUSP00000067842
Gene: ENSMUSG00000055022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141187
Predicted Effect probably benign
Transcript: ENSMUST00000169825
SMART Domains Protein: ENSMUSP00000133063
Gene: ENSMUSG00000055022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 56 121 4.07e-4 SMART
IG 143 232 1.25e-4 SMART
IGc2 254 317 1.24e-17 SMART
IGc2 343 398 4.22e-11 SMART
IGc2 427 491 2.52e-9 SMART
IG 511 603 3.51e-8 SMART
FN3 606 692 6.69e-12 SMART
FN3 709 795 1.17e-2 SMART
FN3 811 892 1.16e-6 SMART
FN3 907 987 2.46e-1 SMART
low complexity region 995 1018 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mutations of this gene result in growth retardation, progressive ataxia and death prior to weaning. A targeted null mutation, but not a spontaneous mutation, causes a small cerebellum with abnormalities of the molecular layer and abnormal Purkinje cellaxon morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik T C 7: 81,788,549 T20A probably benign Het
4932438A13Rik T A 3: 36,987,598 Y2708* probably null Het
9130011E15Rik A T 19: 45,891,240 M558K probably damaging Het
Aadacl4 A G 4: 144,617,941 T96A probably damaging Het
Abcb6 A G 1: 75,175,007 V473A possibly damaging Het
Abo C A 2: 26,843,373 K273N possibly damaging Het
Acvr1c A G 2: 58,315,779 probably benign Het
Adcy8 A T 15: 64,699,368 V1142D probably benign Het
Akna T A 4: 63,382,445 H591L probably benign Het
Aox2 T C 1: 58,354,422 V1247A probably benign Het
Ap4b1 T C 3: 103,820,664 probably benign Het
Atm A G 9: 53,513,180 V607A probably benign Het
Cass4 C T 2: 172,416,492 P137S probably damaging Het
Cfap53 A G 18: 74,300,207 E121G probably damaging Het
Chmp6 T C 11: 119,916,682 V31A probably damaging Het
Clec4a3 T A 6: 122,967,549 Y185N probably damaging Het
Clic5 A G 17: 44,275,313 T230A probably damaging Het
Clspn G T 4: 126,565,003 probably null Het
Col4a3 G A 1: 82,672,753 G577R unknown Het
Defa21 T A 8: 21,025,768 probably null Het
Deup1 T C 9: 15,599,821 R221G possibly damaging Het
Dnah8 A T 17: 30,683,621 probably benign Het
Dnase1l2 A G 17: 24,441,075 V273A probably damaging Het
Gm5134 T A 10: 75,993,864 F328Y probably benign Het
Golph3 A T 15: 12,339,690 E96D probably damaging Het
Hspd1 A G 1: 55,083,783 V151A probably benign Het
Htr1f A C 16: 64,926,497 I144S probably damaging Het
Il1f8 A T 2: 24,159,878 H167L probably benign Het
Il23r A G 6: 67,473,788 probably benign Het
Il25 A G 14: 54,933,096 E42G probably damaging Het
Klrb1-ps1 C T 6: 129,129,343 A149V possibly damaging Het
Kmt2e T A 5: 23,485,621 probably benign Het
Ktn1 A G 14: 47,730,379 N1167D probably benign Het
Lama4 T A 10: 39,072,738 D832E probably benign Het
Map1b A G 13: 99,435,338 S292P probably damaging Het
Map6 C T 7: 99,317,608 T345I probably damaging Het
Mark2 A T 19: 7,284,652 probably benign Het
Me3 C A 7: 89,851,759 H559Q probably benign Het
Myo1b A G 1: 51,778,382 F574L probably damaging Het
Nos2 T C 11: 78,945,727 S431P probably damaging Het
Nr1h5 T A 3: 102,949,573 K208* probably null Het
Nup214 T C 2: 31,990,367 probably null Het
Obp2b T C 2: 25,738,633 L133P probably damaging Het
Olfr173 A T 16: 58,797,122 C241* probably null Het
Olfr305 T C 7: 86,364,187 D50G possibly damaging Het
Osbp2 C T 11: 3,717,997 probably benign Het
Ptafr C A 4: 132,579,553 L85I probably benign Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Rad50 A G 11: 53,655,027 probably benign Het
Rasef G T 4: 73,762,854 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Tbc1d1 T A 5: 64,256,737 I18N probably damaging Het
Tbc1d17 T C 7: 44,841,408 N587D probably benign Het
Trank1 A T 9: 111,366,776 K1289N probably benign Het
Tspyl3 A G 2: 153,224,320 S333P probably damaging Het
Ush2a G A 1: 188,356,888 V347I probably benign Het
Usp17le G T 7: 104,769,062 S291* probably null Het
Usp24 T A 4: 106,368,027 S619T probably benign Het
Vmn2r10 T C 5: 108,997,601 probably benign Het
Vmn2r78 A G 7: 86,920,205 E102G probably benign Het
Vwa3b G A 1: 37,165,689 V85I possibly damaging Het
Wwp1 A C 4: 19,631,116 I639R probably damaging Het
Xpo5 A G 17: 46,240,175 T1001A probably benign Het
Zc3h12c A T 9: 52,143,747 M235K probably benign Het
Zfp619 G A 7: 39,537,282 G912D probably damaging Het
Other mutations in Cntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cntn1 APN 15 92250877 missense possibly damaging 0.92
IGL01109:Cntn1 APN 15 92339577 nonsense probably null
IGL01399:Cntn1 APN 15 92305144 missense probably damaging 1.00
IGL01714:Cntn1 APN 15 92253989 nonsense probably null
IGL02052:Cntn1 APN 15 92291703 missense possibly damaging 0.95
IGL02342:Cntn1 APN 15 92246017 missense probably benign 0.01
IGL02507:Cntn1 APN 15 92250979 missense possibly damaging 0.92
IGL02511:Cntn1 APN 15 92216385 start gained probably benign
IGL02702:Cntn1 APN 15 92291601 splice site probably benign
IGL02927:Cntn1 APN 15 92291680 missense probably benign 0.12
IGL02948:Cntn1 APN 15 92246010 missense probably benign 0.01
R0084:Cntn1 UTSW 15 92317917 missense probably benign 0.01
R0346:Cntn1 UTSW 15 92232087 splice site probably benign
R0634:Cntn1 UTSW 15 92314563 nonsense probably null
R1348:Cntn1 UTSW 15 92314663 missense probably damaging 1.00
R1613:Cntn1 UTSW 15 92245990 missense possibly damaging 0.60
R1793:Cntn1 UTSW 15 92291671 missense possibly damaging 0.92
R1815:Cntn1 UTSW 15 92250948 missense probably benign 0.00
R1851:Cntn1 UTSW 15 92305140 missense probably damaging 1.00
R1852:Cntn1 UTSW 15 92305140 missense probably damaging 1.00
R2068:Cntn1 UTSW 15 92318062 missense possibly damaging 0.82
R2269:Cntn1 UTSW 15 92294982 splice site probably benign
R4394:Cntn1 UTSW 15 92291764 missense probably damaging 1.00
R4667:Cntn1 UTSW 15 92295079 missense probably damaging 1.00
R4771:Cntn1 UTSW 15 92305091 missense possibly damaging 0.82
R4944:Cntn1 UTSW 15 92228668 missense probably damaging 1.00
R5044:Cntn1 UTSW 15 92242995 missense probably damaging 1.00
R5218:Cntn1 UTSW 15 92339549 missense unknown
R5314:Cntn1 UTSW 15 92295011 missense probably benign 0.01
R5445:Cntn1 UTSW 15 92295077 missense probably damaging 1.00
R5518:Cntn1 UTSW 15 92314653 missense probably benign 0.00
R6849:Cntn1 UTSW 15 92305246 missense probably damaging 0.99
R6885:Cntn1 UTSW 15 92243099 critical splice donor site probably null
R7035:Cntn1 UTSW 15 92314511 missense probably benign 0.04
R7070:Cntn1 UTSW 15 92254036 missense probably damaging 1.00
R7287:Cntn1 UTSW 15 92245952 splice site probably null
R7311:Cntn1 UTSW 15 92232275 critical splice donor site probably null
R7401:Cntn1 UTSW 15 92317989 missense probably benign
R7484:Cntn1 UTSW 15 92254041 missense probably benign 0.00
R7492:Cntn1 UTSW 15 92314542 missense probably benign
R7617:Cntn1 UTSW 15 92246089 missense probably damaging 1.00
R7644:Cntn1 UTSW 15 92310009 missense probably benign 0.14
R7878:Cntn1 UTSW 15 92295053 missense probably damaging 1.00
R7961:Cntn1 UTSW 15 92295053 missense probably damaging 1.00
Z1177:Cntn1 UTSW 15 92309970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCTGTGCTACTTAGCCAGATACTC -3'
(R):5'- ACCATTCCGTAGTTGTTGGATGCC -3'

Sequencing Primer
(F):5'- GTGCCTGTGAAACTACCTAGC -3'
(R):5'- GATGCCAGGCAGTAGTACACC -3'
Posted On2013-04-11