Incidental Mutation 'R1766:Slc26a1'
ID194360
Institutional Source Beutler Lab
Gene Symbol Slc26a1
Ensembl Gene ENSMUSG00000046959
Gene Namesolute carrier family 26 (sulfate transporter), member 1
SynonymsSat1
MMRRC Submission 039798-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R1766 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108669878-108675569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108671792 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 514 (R514W)
Ref Sequence ENSEMBL: ENSMUSP00000131282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051757] [ENSMUST00000071650] [ENSMUST00000112563] [ENSMUST00000119212] [ENSMUST00000119270] [ENSMUST00000132708] [ENSMUST00000136227] [ENSMUST00000139734] [ENSMUST00000140620] [ENSMUST00000163328]
Predicted Effect probably damaging
Transcript: ENSMUST00000051757
AA Change: R514W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051561
Gene: ENSMUSG00000046959
AA Change: R514W

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071650
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112563
SMART Domains Protein: ENSMUSP00000108182
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 2.1e-224 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119212
SMART Domains Protein: ENSMUSP00000113190
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Glyco_hydro_39 48 495 2.4e-193 PFAM
SCOP:d1bpv__ 499 596 3e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119270
AA Change: R530W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113185
Gene: ENSMUSG00000046959
AA Change: R530W

DomainStartEndE-ValueType
Pfam:Sulfate_transp 85 498 7.3e-135 PFAM
Pfam:STAS 552 702 1.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136227
SMART Domains Protein: ENSMUSP00000116540
Gene: ENSMUSG00000046959

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 3.4e-31 PFAM
Pfam:Sulfate_transp 200 416 2.2e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139734
SMART Domains Protein: ENSMUSP00000117694
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 199 6.8e-80 PFAM
low complexity region 235 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140620
SMART Domains Protein: ENSMUSP00000119624
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 150 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159464
Predicted Effect probably damaging
Transcript: ENSMUST00000163328
AA Change: R514W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131282
Gene: ENSMUSG00000046959
AA Change: R514W

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 54 137 4.9e-31 PFAM
Pfam:Sulfate_transp 200 478 3.1e-84 PFAM
Pfam:STAS 536 686 9.5e-29 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a family of sulfate/anion transporter genes. Family members are well conserved in their genomic (number and size of exons) and protein (aa length among species) structures, but have markedly different tissue expression patterns. This gene is primarily expressed in the liver, pancreas, and brain. Three splice variants that encode different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene develop kidney stones and have an increased susceptibility to acetaminophen-induced liver damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T C X: 112,241,085 Y22H probably benign Het
Afg1l T C 10: 42,454,495 T59A probably benign Het
Ankrd17 T A 5: 90,264,797 M1223L possibly damaging Het
Ankrd24 G A 10: 81,638,638 S68N probably benign Het
Arhgap31 A G 16: 38,625,590 I131T probably damaging Het
Arhgef10 A T 8: 14,979,836 I874F probably damaging Het
Arl5b T C 2: 15,069,837 V43A probably benign Het
BC051665 G A 13: 60,785,040 H36Y probably benign Het
Cdh9 A G 15: 16,778,306 D69G probably damaging Het
Chd6 G A 2: 160,966,639 L1552F probably damaging Het
Chrd A G 16: 20,737,441 H584R probably damaging Het
Dnhd1 G A 7: 105,693,972 V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 probably null Het
Ehbp1l1 A G 19: 5,716,406 V1303A probably damaging Het
Eif4e1b G A 13: 54,786,891 E182K probably damaging Het
Fam170b A T 14: 32,835,886 Q226L possibly damaging Het
Fam193a C T 5: 34,462,131 P760L probably damaging Het
Gabra5 A T 7: 57,508,048 L6H probably benign Het
Gabrq G A X: 72,833,383 R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7334 T A 17: 50,698,978 D97E probably damaging Het
Gpsm1 G A 2: 26,325,383 A286T probably damaging Het
Gsta4 C A 9: 78,204,329 Y79* probably null Het
Hcn1 T A 13: 117,656,734 V174D probably benign Het
Hic1 G T 11: 75,165,794 C756* probably null Het
Hivep3 C T 4: 120,096,671 T728I probably benign Het
Ice1 T C 13: 70,604,442 E1175G possibly damaging Het
Igsf3 T A 3: 101,431,282 L304Q probably damaging Het
Kpna6 T C 4: 129,657,442 D90G probably benign Het
Krt73 C T 15: 101,793,928 G500D probably damaging Het
Lama3 A G 18: 12,402,062 K156E probably damaging Het
Mdm2 T C 10: 117,696,022 K94E probably damaging Het
Mitf T C 6: 97,941,099 S26P probably damaging Het
Myh4 C A 11: 67,256,295 Q1589K possibly damaging Het
Nlrp4c T A 7: 6,073,114 V671E probably benign Het
Nop9 C T 14: 55,752,134 A407V possibly damaging Het
Nrap T A 19: 56,335,042 H1366L probably damaging Het
Ntrk1 A T 3: 87,778,518 C766S probably damaging Het
Olfr625-ps1 A G 7: 103,682,861 N38D possibly damaging Het
Olfr735 T C 14: 50,346,220 Y43C probably damaging Het
Olfr768 T C 10: 129,093,747 I76V probably benign Het
Olfr845 A G 9: 19,338,858 T133A probably benign Het
Oog3 C T 4: 144,159,122 G302D possibly damaging Het
Pdzph1 C T 17: 58,973,752 V512I probably benign Het
Phf2 A C 13: 48,819,557 S408A unknown Het
Pigk T G 3: 152,740,156 L135V probably damaging Het
Ppp2ca C A 11: 52,121,946 T301N probably benign Het
Ppp4r3a A G 12: 101,058,482 S253P probably damaging Het
Ptgfrn A T 3: 101,050,122 I712N probably benign Het
Rapgef2 A T 3: 79,092,703 D579E probably damaging Het
Rims2 T A 15: 39,462,580 D769E probably damaging Het
Rptor T A 11: 119,725,061 C134S probably damaging Het
S100a1 A G 3: 90,511,292 F72L probably damaging Het
Scube1 T A 15: 83,721,945 D42V probably damaging Het
Sh3glb1 T C 3: 144,712,685 D39G probably damaging Het
Sh3pxd2a T C 19: 47,273,250 T397A probably benign Het
Siglece G A 7: 43,651,532 T453M probably damaging Het
Slc4a8 T C 15: 100,787,212 V156A probably benign Het
Smchd1 A T 17: 71,391,379 V1134E probably damaging Het
Sorbs2 A G 8: 45,770,576 Y222C probably damaging Het
Sorcs3 G T 19: 48,603,875 W326C possibly damaging Het
Taf2 A G 15: 55,071,397 V45A probably benign Het
Tiparp A T 3: 65,532,049 H80L probably damaging Het
Tmem71 T A 15: 66,541,699 T175S probably benign Het
Tmem87b T A 2: 128,839,170 V338D probably damaging Het
Trdn A G 10: 33,364,008 K445R probably damaging Het
Trim14 A G 4: 46,522,039 F213L probably benign Het
Tubgcp5 T A 7: 55,815,020 S550T probably benign Het
Tufm A G 7: 126,490,472 D446G probably benign Het
Vipr1 A T 9: 121,661,419 Y177F possibly damaging Het
Vmn2r116 A C 17: 23,401,766 I825L probably damaging Het
Vmn2r12 G T 5: 109,092,044 Q218K probably damaging Het
Vwa7 G T 17: 35,023,943 probably null Het
Ywhae T C 11: 75,755,665 V119A probably damaging Het
Zfand5 A G 19: 21,280,524 R199G probably damaging Het
Zfp810 T C 9: 22,278,532 Y360C possibly damaging Het
Zrsr1 A G 11: 22,973,637 D137G probably benign Het
Other mutations in Slc26a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Slc26a1 APN 5 108671878 missense possibly damaging 0.75
IGL02566:Slc26a1 APN 5 108673799 missense probably damaging 1.00
IGL03347:Slc26a1 APN 5 108673810 missense probably damaging 1.00
R0744:Slc26a1 UTSW 5 108673523 missense probably benign 0.01
R0833:Slc26a1 UTSW 5 108673523 missense probably benign 0.01
R1518:Slc26a1 UTSW 5 108671874 nonsense probably null
R1726:Slc26a1 UTSW 5 108673675 missense probably damaging 1.00
R1975:Slc26a1 UTSW 5 108672472 missense probably damaging 1.00
R3953:Slc26a1 UTSW 5 108673582 missense possibly damaging 0.85
R3954:Slc26a1 UTSW 5 108673582 missense possibly damaging 0.85
R3955:Slc26a1 UTSW 5 108673582 missense possibly damaging 0.85
R3969:Slc26a1 UTSW 5 108673952 missense probably benign
R4259:Slc26a1 UTSW 5 108672630 missense probably damaging 1.00
R5875:Slc26a1 UTSW 5 108672037 missense probably damaging 1.00
R6036:Slc26a1 UTSW 5 108673570 missense probably damaging 1.00
R6036:Slc26a1 UTSW 5 108673570 missense probably damaging 1.00
R6057:Slc26a1 UTSW 5 108673765 missense probably damaging 1.00
R6088:Slc26a1 UTSW 5 108674006 missense possibly damaging 0.84
R6766:Slc26a1 UTSW 5 108671907 missense probably damaging 0.99
R7230:Slc26a1 UTSW 5 108671745 missense probably damaging 1.00
R7294:Slc26a1 UTSW 5 108673832 missense possibly damaging 0.90
R7580:Slc26a1 UTSW 5 108671869 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCCTTGCCATCGACAAGACTCC -3'
(R):5'- GCTTGTATCATTGTTGTCAGCCTGC -3'

Sequencing Primer
(F):5'- ATCGACAAGACTCCTGTTACTG -3'
(R):5'- AAGGTGAAGGATCTCCCACA -3'
Posted On2014-05-23