Incidental Mutation 'R1766:Vmn2r12'
ID 194361
Institutional Source Beutler Lab
Gene Symbol Vmn2r12
Ensembl Gene ENSMUSG00000090688
Gene Name vomeronasal 2, receptor 12
Synonyms Gm6769
MMRRC Submission 039798-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R1766 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 109233715-109245730 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 109239910 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 218 (Q218K)
Ref Sequence ENSEMBL: ENSMUSP00000093612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095922]
AlphaFold L7N217
Predicted Effect probably damaging
Transcript: ENSMUST00000095922
AA Change: Q218K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093612
Gene: ENSMUSG00000090688
AA Change: Q218K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 76 466 8.8e-30 PFAM
Pfam:NCD3G 505 559 1.7e-18 PFAM
Pfam:7tm_3 591 827 3.9e-54 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l T C 10: 42,330,491 (GRCm39) T59A probably benign Het
Ankrd17 T A 5: 90,412,656 (GRCm39) M1223L possibly damaging Het
Ankrd24 G A 10: 81,474,472 (GRCm39) S68N probably benign Het
Arhgap31 A G 16: 38,445,952 (GRCm39) I131T probably damaging Het
Arhgef10 A T 8: 15,029,836 (GRCm39) I874F probably damaging Het
Arl5b T C 2: 15,074,648 (GRCm39) V43A probably benign Het
BC051665 G A 13: 60,932,854 (GRCm39) H36Y probably benign Het
Cdh9 A G 15: 16,778,392 (GRCm39) D69G probably damaging Het
Chd6 G A 2: 160,808,559 (GRCm39) L1552F probably damaging Het
Chrd A G 16: 20,556,191 (GRCm39) H584R probably damaging Het
Dnhd1 G A 7: 105,343,179 (GRCm39) V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 (GRCm39) G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 (GRCm39) probably null Het
Ehbp1l1 A G 19: 5,766,434 (GRCm39) V1303A probably damaging Het
Eif4e1b G A 13: 54,934,704 (GRCm39) E182K probably damaging Het
Fam170b A T 14: 32,557,843 (GRCm39) Q226L possibly damaging Het
Fam193a C T 5: 34,619,475 (GRCm39) P760L probably damaging Het
Gabra5 A T 7: 57,157,796 (GRCm39) L6H probably benign Het
Gabrq G A X: 71,876,989 (GRCm39) R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm7334 T A 17: 51,006,006 (GRCm39) D97E probably damaging Het
Gpsm1 G A 2: 26,215,395 (GRCm39) A286T probably damaging Het
Gsta4 C A 9: 78,111,611 (GRCm39) Y79* probably null Het
Hcn1 T A 13: 117,793,270 (GRCm39) V174D probably benign Het
Hic1 G T 11: 75,056,620 (GRCm39) C756* probably null Het
Hivep3 C T 4: 119,953,868 (GRCm39) T728I probably benign Het
Ice1 T C 13: 70,752,561 (GRCm39) E1175G possibly damaging Het
Igsf3 T A 3: 101,338,598 (GRCm39) L304Q probably damaging Het
Kpna6 T C 4: 129,551,235 (GRCm39) D90G probably benign Het
Krt73 C T 15: 101,702,363 (GRCm39) G500D probably damaging Het
Lama3 A G 18: 12,535,119 (GRCm39) K156E probably damaging Het
Mdm2 T C 10: 117,531,927 (GRCm39) K94E probably damaging Het
Mitf T C 6: 97,918,060 (GRCm39) S26P probably damaging Het
Myh4 C A 11: 67,147,121 (GRCm39) Q1589K possibly damaging Het
Nlrp4c T A 7: 6,076,113 (GRCm39) V671E probably benign Het
Nop9 C T 14: 55,989,591 (GRCm39) A407V possibly damaging Het
Nrap T A 19: 56,323,474 (GRCm39) H1366L probably damaging Het
Ntrk1 A T 3: 87,685,825 (GRCm39) C766S probably damaging Het
Oog3 C T 4: 143,885,692 (GRCm39) G302D possibly damaging Het
Or4q3 T C 14: 50,583,677 (GRCm39) Y43C probably damaging Het
Or52z15 A G 7: 103,332,068 (GRCm39) N38D possibly damaging Het
Or6c38 T C 10: 128,929,616 (GRCm39) I76V probably benign Het
Or7g27 A G 9: 19,250,154 (GRCm39) T133A probably benign Het
Pdzph1 C T 17: 59,280,747 (GRCm39) V512I probably benign Het
Phf2 A C 13: 48,973,033 (GRCm39) S408A unknown Het
Pigk T G 3: 152,445,793 (GRCm39) L135V probably damaging Het
Ppp2ca C A 11: 52,012,773 (GRCm39) T301N probably benign Het
Ppp4r3a A G 12: 101,024,741 (GRCm39) S253P probably damaging Het
Ptgfrn A T 3: 100,957,438 (GRCm39) I712N probably benign Het
Rapgef2 A T 3: 79,000,010 (GRCm39) D579E probably damaging Het
Rims2 T A 15: 39,325,976 (GRCm39) D769E probably damaging Het
Rptor T A 11: 119,615,887 (GRCm39) C134S probably damaging Het
S100a1 A G 3: 90,418,599 (GRCm39) F72L probably damaging Het
Scube1 T A 15: 83,606,146 (GRCm39) D42V probably damaging Het
Sh3glb1 T C 3: 144,418,446 (GRCm39) D39G probably damaging Het
Sh3pxd2a T C 19: 47,261,689 (GRCm39) T397A probably benign Het
Siglece G A 7: 43,300,956 (GRCm39) T453M probably damaging Het
Slc26a1 G A 5: 108,819,658 (GRCm39) R514W probably damaging Het
Slc4a8 T C 15: 100,685,093 (GRCm39) V156A probably benign Het
Smchd1 A T 17: 71,698,374 (GRCm39) V1134E probably damaging Het
Sorbs2 A G 8: 46,223,613 (GRCm39) Y222C probably damaging Het
Sorcs3 G T 19: 48,592,314 (GRCm39) W326C possibly damaging Het
Taf2 A G 15: 54,934,793 (GRCm39) V45A probably benign Het
Tex16 T C X: 111,150,782 (GRCm39) Y22H probably benign Het
Tiparp A T 3: 65,439,470 (GRCm39) H80L probably damaging Het
Tmem71 T A 15: 66,413,548 (GRCm39) T175S probably benign Het
Tmem87b T A 2: 128,681,090 (GRCm39) V338D probably damaging Het
Trdn A G 10: 33,240,004 (GRCm39) K445R probably damaging Het
Trim14 A G 4: 46,522,039 (GRCm39) F213L probably benign Het
Tubgcp5 T A 7: 55,464,768 (GRCm39) S550T probably benign Het
Tufm A G 7: 126,089,644 (GRCm39) D446G probably benign Het
Vipr1 A T 9: 121,490,485 (GRCm39) Y177F possibly damaging Het
Vmn2r116 A C 17: 23,620,740 (GRCm39) I825L probably damaging Het
Vwa7 G T 17: 35,242,919 (GRCm39) probably null Het
Ywhae T C 11: 75,646,491 (GRCm39) V119A probably damaging Het
Zfand5 A G 19: 21,257,888 (GRCm39) R199G probably damaging Het
Zfp810 T C 9: 22,189,828 (GRCm39) Y360C possibly damaging Het
Zrsr2-ps1 A G 11: 22,923,637 (GRCm39) D137G probably benign Het
Other mutations in Vmn2r12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Vmn2r12 APN 5 109,245,541 (GRCm39) missense possibly damaging 0.47
IGL01096:Vmn2r12 APN 5 109,234,125 (GRCm39) missense probably damaging 1.00
IGL01538:Vmn2r12 APN 5 109,239,716 (GRCm39) missense probably damaging 1.00
IGL01548:Vmn2r12 APN 5 109,240,893 (GRCm39) nonsense probably null
IGL01762:Vmn2r12 APN 5 109,234,430 (GRCm39) missense probably damaging 0.99
IGL01860:Vmn2r12 APN 5 109,240,025 (GRCm39) missense probably benign 0.10
IGL02269:Vmn2r12 APN 5 109,234,343 (GRCm39) missense probably damaging 1.00
IGL02530:Vmn2r12 APN 5 109,233,858 (GRCm39) missense probably damaging 1.00
IGL02887:Vmn2r12 APN 5 109,238,351 (GRCm39) missense probably benign 0.03
IGL03265:Vmn2r12 APN 5 109,239,936 (GRCm39) missense probably benign 0.05
R0396:Vmn2r12 UTSW 5 109,240,765 (GRCm39) missense probably benign 0.00
R0497:Vmn2r12 UTSW 5 109,239,755 (GRCm39) nonsense probably null
R0529:Vmn2r12 UTSW 5 109,240,714 (GRCm39) missense probably benign
R0715:Vmn2r12 UTSW 5 109,238,373 (GRCm39) missense probably benign 0.10
R0742:Vmn2r12 UTSW 5 109,234,281 (GRCm39) missense possibly damaging 0.55
R0894:Vmn2r12 UTSW 5 109,235,716 (GRCm39) critical splice donor site probably null
R1173:Vmn2r12 UTSW 5 109,240,720 (GRCm39) missense probably benign 0.00
R1174:Vmn2r12 UTSW 5 109,240,720 (GRCm39) missense probably benign 0.00
R1259:Vmn2r12 UTSW 5 109,239,763 (GRCm39) missense probably damaging 0.97
R1349:Vmn2r12 UTSW 5 109,234,452 (GRCm39) missense probably benign 0.00
R1388:Vmn2r12 UTSW 5 109,240,840 (GRCm39) missense possibly damaging 0.56
R1549:Vmn2r12 UTSW 5 109,240,696 (GRCm39) missense probably benign 0.06
R1781:Vmn2r12 UTSW 5 109,239,594 (GRCm39) missense probably benign 0.00
R1885:Vmn2r12 UTSW 5 109,239,942 (GRCm39) missense probably damaging 1.00
R2159:Vmn2r12 UTSW 5 109,239,340 (GRCm39) missense probably benign 0.02
R2420:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2421:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2422:Vmn2r12 UTSW 5 109,234,398 (GRCm39) missense probably benign 0.39
R2937:Vmn2r12 UTSW 5 109,239,397 (GRCm39) missense probably damaging 1.00
R2938:Vmn2r12 UTSW 5 109,239,397 (GRCm39) missense probably damaging 1.00
R3898:Vmn2r12 UTSW 5 109,238,370 (GRCm39) missense probably benign 0.02
R4061:Vmn2r12 UTSW 5 109,240,058 (GRCm39) missense possibly damaging 0.95
R4063:Vmn2r12 UTSW 5 109,240,058 (GRCm39) missense possibly damaging 0.95
R4090:Vmn2r12 UTSW 5 109,239,412 (GRCm39) missense probably benign 0.06
R4297:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4298:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4299:Vmn2r12 UTSW 5 109,239,830 (GRCm39) missense probably benign 0.12
R4304:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4306:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4307:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4308:Vmn2r12 UTSW 5 109,233,872 (GRCm39) missense probably damaging 1.00
R4594:Vmn2r12 UTSW 5 109,234,301 (GRCm39) missense probably damaging 1.00
R4783:Vmn2r12 UTSW 5 109,234,379 (GRCm39) missense probably damaging 1.00
R4900:Vmn2r12 UTSW 5 109,240,852 (GRCm39) missense probably damaging 1.00
R4929:Vmn2r12 UTSW 5 109,239,544 (GRCm39) missense probably damaging 1.00
R4974:Vmn2r12 UTSW 5 109,239,372 (GRCm39) missense probably damaging 1.00
R5389:Vmn2r12 UTSW 5 109,238,261 (GRCm39) missense probably benign 0.00
R5431:Vmn2r12 UTSW 5 109,239,684 (GRCm39) missense probably damaging 0.99
R5527:Vmn2r12 UTSW 5 109,234,483 (GRCm39) nonsense probably null
R5639:Vmn2r12 UTSW 5 109,240,666 (GRCm39) missense probably benign 0.06
R5753:Vmn2r12 UTSW 5 109,239,670 (GRCm39) missense probably damaging 1.00
R5797:Vmn2r12 UTSW 5 109,233,736 (GRCm39) nonsense probably null
R6142:Vmn2r12 UTSW 5 109,240,763 (GRCm39) missense probably benign
R6162:Vmn2r12 UTSW 5 109,234,430 (GRCm39) missense probably damaging 0.99
R6176:Vmn2r12 UTSW 5 109,233,866 (GRCm39) missense probably benign 0.43
R6853:Vmn2r12 UTSW 5 109,240,771 (GRCm39) missense probably damaging 1.00
R7238:Vmn2r12 UTSW 5 109,245,655 (GRCm39) missense possibly damaging 0.81
R7341:Vmn2r12 UTSW 5 109,239,811 (GRCm39) missense possibly damaging 0.95
R7341:Vmn2r12 UTSW 5 109,234,113 (GRCm39) missense possibly damaging 0.74
R7383:Vmn2r12 UTSW 5 109,240,684 (GRCm39) missense probably benign 0.19
R7740:Vmn2r12 UTSW 5 109,239,615 (GRCm39) missense probably damaging 1.00
R7749:Vmn2r12 UTSW 5 109,233,920 (GRCm39) missense probably damaging 0.99
R7861:Vmn2r12 UTSW 5 109,235,829 (GRCm39) missense probably benign 0.00
R7908:Vmn2r12 UTSW 5 109,234,307 (GRCm39) missense probably damaging 1.00
R8128:Vmn2r12 UTSW 5 109,239,747 (GRCm39) missense possibly damaging 0.81
R8175:Vmn2r12 UTSW 5 109,238,349 (GRCm39) missense probably damaging 0.97
R8234:Vmn2r12 UTSW 5 109,234,074 (GRCm39) missense probably benign 0.01
R8771:Vmn2r12 UTSW 5 109,239,952 (GRCm39) missense possibly damaging 0.95
R8947:Vmn2r12 UTSW 5 109,234,522 (GRCm39) missense possibly damaging 0.64
R8991:Vmn2r12 UTSW 5 109,234,033 (GRCm39) nonsense probably null
R9116:Vmn2r12 UTSW 5 109,233,885 (GRCm39) missense probably damaging 1.00
R9122:Vmn2r12 UTSW 5 109,240,910 (GRCm39) missense probably benign 0.00
R9153:Vmn2r12 UTSW 5 109,234,203 (GRCm39) missense probably damaging 1.00
R9371:Vmn2r12 UTSW 5 109,234,452 (GRCm39) missense probably benign 0.00
R9375:Vmn2r12 UTSW 5 109,233,986 (GRCm39) missense probably damaging 1.00
R9524:Vmn2r12 UTSW 5 109,239,823 (GRCm39) missense probably damaging 1.00
R9587:Vmn2r12 UTSW 5 109,239,322 (GRCm39) missense probably damaging 0.99
Z1088:Vmn2r12 UTSW 5 109,240,646 (GRCm39) missense probably benign
Z1176:Vmn2r12 UTSW 5 109,239,303 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCGATCCAGATTCTCCTTACACCTT -3'
(R):5'- ACTGGGAAAACAGGCAAACTGTCAA -3'

Sequencing Primer
(F):5'- CCTTCTAAAGCTGACTTCTAGGGTAG -3'
(R):5'- CAGGCAAACTGTCAAGAATACTC -3'
Posted On 2014-05-23