Incidental Mutation 'R1766:Or52z15'
ID 194367
Institutional Source Beutler Lab
Gene Symbol Or52z15
Ensembl Gene ENSMUSG00000073943
Gene Name olfactory receptor family 52 subfamily Z member 15
Synonyms MOR31-15P, GA_x6K02T2PBJ9-6416276-6417237, Olfr625
MMRRC Submission 039798-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R1766 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103331936-103332889 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103332068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 38 (N38D)
Ref Sequence ENSEMBL: ENSMUSP00000140044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098195] [ENSMUST00000190218]
AlphaFold A0A140T8L4
Predicted Effect possibly damaging
Transcript: ENSMUST00000098195
AA Change: N48D

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095797
Gene: ENSMUSG00000073943
AA Change: N48D

DomainStartEndE-ValueType
Pfam:7tm_4 37 317 8.1e-110 PFAM
Pfam:7TM_GPCR_Srsx 41 225 3.6e-9 PFAM
Pfam:7tm_1 47 299 1.6e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190218
AA Change: N38D

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140044
Gene: ENSMUSG00000073943
AA Change: N38D

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 31 214 7e-8 PFAM
Pfam:7tm_1 37 289 2.8e-26 PFAM
Pfam:7tm_4 136 282 2.7e-28 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l T C 10: 42,330,491 (GRCm39) T59A probably benign Het
Ankrd17 T A 5: 90,412,656 (GRCm39) M1223L possibly damaging Het
Ankrd24 G A 10: 81,474,472 (GRCm39) S68N probably benign Het
Arhgap31 A G 16: 38,445,952 (GRCm39) I131T probably damaging Het
Arhgef10 A T 8: 15,029,836 (GRCm39) I874F probably damaging Het
Arl5b T C 2: 15,074,648 (GRCm39) V43A probably benign Het
BC051665 G A 13: 60,932,854 (GRCm39) H36Y probably benign Het
Cdh9 A G 15: 16,778,392 (GRCm39) D69G probably damaging Het
Chd6 G A 2: 160,808,559 (GRCm39) L1552F probably damaging Het
Chrd A G 16: 20,556,191 (GRCm39) H584R probably damaging Het
Dnhd1 G A 7: 105,343,179 (GRCm39) V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 (GRCm39) G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 (GRCm39) probably null Het
Ehbp1l1 A G 19: 5,766,434 (GRCm39) V1303A probably damaging Het
Eif4e1b G A 13: 54,934,704 (GRCm39) E182K probably damaging Het
Fam170b A T 14: 32,557,843 (GRCm39) Q226L possibly damaging Het
Fam193a C T 5: 34,619,475 (GRCm39) P760L probably damaging Het
Gabra5 A T 7: 57,157,796 (GRCm39) L6H probably benign Het
Gabrq G A X: 71,876,989 (GRCm39) R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm7334 T A 17: 51,006,006 (GRCm39) D97E probably damaging Het
Gpsm1 G A 2: 26,215,395 (GRCm39) A286T probably damaging Het
Gsta4 C A 9: 78,111,611 (GRCm39) Y79* probably null Het
Hcn1 T A 13: 117,793,270 (GRCm39) V174D probably benign Het
Hic1 G T 11: 75,056,620 (GRCm39) C756* probably null Het
Hivep3 C T 4: 119,953,868 (GRCm39) T728I probably benign Het
Ice1 T C 13: 70,752,561 (GRCm39) E1175G possibly damaging Het
Igsf3 T A 3: 101,338,598 (GRCm39) L304Q probably damaging Het
Kpna6 T C 4: 129,551,235 (GRCm39) D90G probably benign Het
Krt73 C T 15: 101,702,363 (GRCm39) G500D probably damaging Het
Lama3 A G 18: 12,535,119 (GRCm39) K156E probably damaging Het
Mdm2 T C 10: 117,531,927 (GRCm39) K94E probably damaging Het
Mitf T C 6: 97,918,060 (GRCm39) S26P probably damaging Het
Myh4 C A 11: 67,147,121 (GRCm39) Q1589K possibly damaging Het
Nlrp4c T A 7: 6,076,113 (GRCm39) V671E probably benign Het
Nop9 C T 14: 55,989,591 (GRCm39) A407V possibly damaging Het
Nrap T A 19: 56,323,474 (GRCm39) H1366L probably damaging Het
Ntrk1 A T 3: 87,685,825 (GRCm39) C766S probably damaging Het
Oog3 C T 4: 143,885,692 (GRCm39) G302D possibly damaging Het
Or4q3 T C 14: 50,583,677 (GRCm39) Y43C probably damaging Het
Or6c38 T C 10: 128,929,616 (GRCm39) I76V probably benign Het
Or7g27 A G 9: 19,250,154 (GRCm39) T133A probably benign Het
Pdzph1 C T 17: 59,280,747 (GRCm39) V512I probably benign Het
Phf2 A C 13: 48,973,033 (GRCm39) S408A unknown Het
Pigk T G 3: 152,445,793 (GRCm39) L135V probably damaging Het
Ppp2ca C A 11: 52,012,773 (GRCm39) T301N probably benign Het
Ppp4r3a A G 12: 101,024,741 (GRCm39) S253P probably damaging Het
Ptgfrn A T 3: 100,957,438 (GRCm39) I712N probably benign Het
Rapgef2 A T 3: 79,000,010 (GRCm39) D579E probably damaging Het
Rims2 T A 15: 39,325,976 (GRCm39) D769E probably damaging Het
Rptor T A 11: 119,615,887 (GRCm39) C134S probably damaging Het
S100a1 A G 3: 90,418,599 (GRCm39) F72L probably damaging Het
Scube1 T A 15: 83,606,146 (GRCm39) D42V probably damaging Het
Sh3glb1 T C 3: 144,418,446 (GRCm39) D39G probably damaging Het
Sh3pxd2a T C 19: 47,261,689 (GRCm39) T397A probably benign Het
Siglece G A 7: 43,300,956 (GRCm39) T453M probably damaging Het
Slc26a1 G A 5: 108,819,658 (GRCm39) R514W probably damaging Het
Slc4a8 T C 15: 100,685,093 (GRCm39) V156A probably benign Het
Smchd1 A T 17: 71,698,374 (GRCm39) V1134E probably damaging Het
Sorbs2 A G 8: 46,223,613 (GRCm39) Y222C probably damaging Het
Sorcs3 G T 19: 48,592,314 (GRCm39) W326C possibly damaging Het
Taf2 A G 15: 54,934,793 (GRCm39) V45A probably benign Het
Tex16 T C X: 111,150,782 (GRCm39) Y22H probably benign Het
Tiparp A T 3: 65,439,470 (GRCm39) H80L probably damaging Het
Tmem71 T A 15: 66,413,548 (GRCm39) T175S probably benign Het
Tmem87b T A 2: 128,681,090 (GRCm39) V338D probably damaging Het
Trdn A G 10: 33,240,004 (GRCm39) K445R probably damaging Het
Trim14 A G 4: 46,522,039 (GRCm39) F213L probably benign Het
Tubgcp5 T A 7: 55,464,768 (GRCm39) S550T probably benign Het
Tufm A G 7: 126,089,644 (GRCm39) D446G probably benign Het
Vipr1 A T 9: 121,490,485 (GRCm39) Y177F possibly damaging Het
Vmn2r116 A C 17: 23,620,740 (GRCm39) I825L probably damaging Het
Vmn2r12 G T 5: 109,239,910 (GRCm39) Q218K probably damaging Het
Vwa7 G T 17: 35,242,919 (GRCm39) probably null Het
Ywhae T C 11: 75,646,491 (GRCm39) V119A probably damaging Het
Zfand5 A G 19: 21,257,888 (GRCm39) R199G probably damaging Het
Zfp810 T C 9: 22,189,828 (GRCm39) Y360C possibly damaging Het
Zrsr2-ps1 A G 11: 22,923,637 (GRCm39) D137G probably benign Het
Other mutations in Or52z15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02547:Or52z15 APN 7 103,331,973 (GRCm39) missense probably benign 0.01
R1160:Or52z15 UTSW 7 103,332,068 (GRCm39) missense possibly damaging 0.50
R1508:Or52z15 UTSW 7 103,332,678 (GRCm39) missense possibly damaging 0.50
R1901:Or52z15 UTSW 7 103,332,750 (GRCm39) missense probably damaging 0.98
R2116:Or52z15 UTSW 7 103,332,519 (GRCm39) missense probably damaging 1.00
R4701:Or52z15 UTSW 7 103,332,269 (GRCm39) missense probably damaging 1.00
R4995:Or52z15 UTSW 7 103,332,574 (GRCm39) missense probably damaging 1.00
R5198:Or52z15 UTSW 7 103,331,936 (GRCm39) missense probably benign 0.40
R5750:Or52z15 UTSW 7 103,332,362 (GRCm39) missense possibly damaging 0.95
R5776:Or52z15 UTSW 7 103,332,246 (GRCm39) missense probably damaging 1.00
R5905:Or52z15 UTSW 7 103,332,781 (GRCm39) missense probably damaging 1.00
R5933:Or52z15 UTSW 7 103,332,680 (GRCm39) missense probably damaging 1.00
R6488:Or52z15 UTSW 7 103,332,285 (GRCm39) missense probably damaging 0.98
R7846:Or52z15 UTSW 7 103,332,407 (GRCm39) missense probably benign 0.03
R7878:Or52z15 UTSW 7 103,332,471 (GRCm39) missense probably damaging 1.00
R9170:Or52z15 UTSW 7 103,332,404 (GRCm39) missense probably benign 0.00
R9347:Or52z15 UTSW 7 103,332,464 (GRCm39) missense probably damaging 0.97
R9474:Or52z15 UTSW 7 103,332,477 (GRCm39) missense probably damaging 1.00
R9781:Or52z15 UTSW 7 103,332,246 (GRCm39) missense probably damaging 1.00
RF040:Or52z15 UTSW 7 103,332,145 (GRCm39) frame shift probably null
Z1088:Or52z15 UTSW 7 103,332,393 (GRCm39) missense probably benign 0.01
Z1176:Or52z15 UTSW 7 103,332,312 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TTTGGCAGGCCCAGAACTAGTAGG -3'
(R):5'- ACGGTCAAATGCCATAGCCAGCAG -3'

Sequencing Primer
(F):5'- GGCAAAATAAAGATGACAACATCTTC -3'
(R):5'- GCAGATTCTGCCACAAATATGAAG -3'
Posted On 2014-05-23