Incidental Mutation 'R0035:Olfr173'
ID19437
Institutional Source Beutler Lab
Gene Symbol Olfr173
Ensembl Gene ENSMUSG00000049362
Gene Nameolfactory receptor 173
SynonymsMOR184-3, GA_x54KRFPKG5P-54960233-54959268
MMRRC Submission 038329-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R0035 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location58795207-58800268 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58797122 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 241 (C241*)
Ref Sequence ENSEMBL: ENSMUSP00000145946 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049940] [ENSMUST00000206205]
Predicted Effect probably null
Transcript: ENSMUST00000049940
AA Change: C241*
SMART Domains Protein: ENSMUSP00000052798
Gene: ENSMUSG00000049362
AA Change: C241*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-52 PFAM
Pfam:7tm_1 41 290 9.7e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000206205
AA Change: C241*
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik T C 7: 81,788,549 T20A probably benign Het
4932438A13Rik T A 3: 36,987,598 Y2708* probably null Het
9130011E15Rik A T 19: 45,891,240 M558K probably damaging Het
Aadacl4 A G 4: 144,617,941 T96A probably damaging Het
Abcb6 A G 1: 75,175,007 V473A possibly damaging Het
Abo C A 2: 26,843,373 K273N possibly damaging Het
Acvr1c A G 2: 58,315,779 probably benign Het
Adcy8 A T 15: 64,699,368 V1142D probably benign Het
Akna T A 4: 63,382,445 H591L probably benign Het
Aox2 T C 1: 58,354,422 V1247A probably benign Het
Ap4b1 T C 3: 103,820,664 probably benign Het
Atm A G 9: 53,513,180 V607A probably benign Het
Cass4 C T 2: 172,416,492 P137S probably damaging Het
Cfap53 A G 18: 74,300,207 E121G probably damaging Het
Chmp6 T C 11: 119,916,682 V31A probably damaging Het
Clec4a3 T A 6: 122,967,549 Y185N probably damaging Het
Clic5 A G 17: 44,275,313 T230A probably damaging Het
Clspn G T 4: 126,565,003 probably null Het
Cntn1 T A 15: 92,232,088 probably benign Het
Col4a3 G A 1: 82,672,753 G577R unknown Het
Defa21 T A 8: 21,025,768 probably null Het
Deup1 T C 9: 15,599,821 R221G possibly damaging Het
Dnah8 A T 17: 30,683,621 probably benign Het
Dnase1l2 A G 17: 24,441,075 V273A probably damaging Het
Gm5134 T A 10: 75,993,864 F328Y probably benign Het
Golph3 A T 15: 12,339,690 E96D probably damaging Het
Hspd1 A G 1: 55,083,783 V151A probably benign Het
Htr1f A C 16: 64,926,497 I144S probably damaging Het
Il1f8 A T 2: 24,159,878 H167L probably benign Het
Il23r A G 6: 67,473,788 probably benign Het
Il25 A G 14: 54,933,096 E42G probably damaging Het
Klrb1-ps1 C T 6: 129,129,343 A149V possibly damaging Het
Kmt2e T A 5: 23,485,621 probably benign Het
Ktn1 A G 14: 47,730,379 N1167D probably benign Het
Lama4 T A 10: 39,072,738 D832E probably benign Het
Map1b A G 13: 99,435,338 S292P probably damaging Het
Map6 C T 7: 99,317,608 T345I probably damaging Het
Mark2 A T 19: 7,284,652 probably benign Het
Me3 C A 7: 89,851,759 H559Q probably benign Het
Myo1b A G 1: 51,778,382 F574L probably damaging Het
Nos2 T C 11: 78,945,727 S431P probably damaging Het
Nr1h5 T A 3: 102,949,573 K208* probably null Het
Nup214 T C 2: 31,990,367 probably null Het
Obp2b T C 2: 25,738,633 L133P probably damaging Het
Olfr305 T C 7: 86,364,187 D50G possibly damaging Het
Osbp2 C T 11: 3,717,997 probably benign Het
Ptafr C A 4: 132,579,553 L85I probably benign Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Rad50 A G 11: 53,655,027 probably benign Het
Rasef G T 4: 73,762,854 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Tbc1d1 T A 5: 64,256,737 I18N probably damaging Het
Tbc1d17 T C 7: 44,841,408 N587D probably benign Het
Trank1 A T 9: 111,366,776 K1289N probably benign Het
Tspyl3 A G 2: 153,224,320 S333P probably damaging Het
Ush2a G A 1: 188,356,888 V347I probably benign Het
Usp17le G T 7: 104,769,062 S291* probably null Het
Usp24 T A 4: 106,368,027 S619T probably benign Het
Vmn2r10 T C 5: 108,997,601 probably benign Het
Vmn2r78 A G 7: 86,920,205 E102G probably benign Het
Vwa3b G A 1: 37,165,689 V85I possibly damaging Het
Wwp1 A C 4: 19,631,116 I639R probably damaging Het
Xpo5 A G 17: 46,240,175 T1001A probably benign Het
Zc3h12c A T 9: 52,143,747 M235K probably benign Het
Zfp619 G A 7: 39,537,282 G912D probably damaging Het
Other mutations in Olfr173
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02649:Olfr173 APN 16 58797350 missense probably damaging 1.00
IGL02728:Olfr173 APN 16 58797480 missense probably benign 0.07
IGL02893:Olfr173 APN 16 58797657 missense probably damaging 1.00
R0480:Olfr173 UTSW 16 58797321 missense probably benign 0.05
R1101:Olfr173 UTSW 16 58797252 missense probably benign 0.27
R1434:Olfr173 UTSW 16 58797448 missense probably benign 0.06
R1992:Olfr173 UTSW 16 58796946 missense probably benign
R2220:Olfr173 UTSW 16 58797624 missense possibly damaging 0.69
R2436:Olfr173 UTSW 16 58797244 missense probably benign 0.00
R4212:Olfr173 UTSW 16 58797369 missense possibly damaging 0.67
R4910:Olfr173 UTSW 16 58797442 missense probably benign 0.03
R5666:Olfr173 UTSW 16 58797061 missense possibly damaging 0.75
R5670:Olfr173 UTSW 16 58797061 missense possibly damaging 0.75
R5896:Olfr173 UTSW 16 58797732 missense probably damaging 1.00
R6182:Olfr173 UTSW 16 58797292 missense probably damaging 1.00
R6613:Olfr173 UTSW 16 58797531 missense probably damaging 0.99
R6723:Olfr173 UTSW 16 58797432 missense probably benign 0.06
R7051:Olfr173 UTSW 16 58797175 missense probably benign 0.21
R7141:Olfr173 UTSW 16 58797408 missense probably benign 0.05
R7179:Olfr173 UTSW 16 58796887 missense probably benign 0.00
R7602:Olfr173 UTSW 16 58796980 missense possibly damaging 0.62
Z1176:Olfr173 UTSW 16 58797423 missense probably damaging 1.00
Z1176:Olfr173 UTSW 16 58797673 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAATGACGTGAGACTGGTAGCAGAC -3'
(R):5'- TGTACAGACTCTCCTGTGTTGACCC -3'

Sequencing Primer
(F):5'- AGACTGGTAGCAGACTATTTGG -3'
(R):5'- GTGTTGACCCCTATATCAACGAG -3'
Posted On2013-04-11