Incidental Mutation 'R1766:Olfr735'
ID194403
Institutional Source Beutler Lab
Gene Symbol Olfr735
Ensembl Gene ENSMUSG00000046210
Gene Nameolfactory receptor 735
SynonymsMOR243-1, GA_x6K02T2PMLR-6042130-6041183
MMRRC Submission 039798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R1766 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location50342612-50348872 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50346220 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 43 (Y43C)
Ref Sequence ENSEMBL: ENSMUSP00000153148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049729] [ENSMUST00000216634]
Predicted Effect probably damaging
Transcript: ENSMUST00000049729
AA Change: Y74C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056851
Gene: ENSMUSG00000046210
AA Change: Y74C

DomainStartEndE-ValueType
transmembrane domain 9 28 N/A INTRINSIC
Pfam:7tm_4 70 345 1.6e-49 PFAM
Pfam:7tm_1 80 345 1.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206546
Predicted Effect probably damaging
Transcript: ENSMUST00000216634
AA Change: Y43C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T C X: 112,241,085 Y22H probably benign Het
Afg1l T C 10: 42,454,495 T59A probably benign Het
Ankrd17 T A 5: 90,264,797 M1223L possibly damaging Het
Ankrd24 G A 10: 81,638,638 S68N probably benign Het
Arhgap31 A G 16: 38,625,590 I131T probably damaging Het
Arhgef10 A T 8: 14,979,836 I874F probably damaging Het
Arl5b T C 2: 15,069,837 V43A probably benign Het
BC051665 G A 13: 60,785,040 H36Y probably benign Het
Cdh9 A G 15: 16,778,306 D69G probably damaging Het
Chd6 G A 2: 160,966,639 L1552F probably damaging Het
Chrd A G 16: 20,737,441 H584R probably damaging Het
Dnhd1 G A 7: 105,693,972 V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 probably null Het
Ehbp1l1 A G 19: 5,716,406 V1303A probably damaging Het
Eif4e1b G A 13: 54,786,891 E182K probably damaging Het
Fam170b A T 14: 32,835,886 Q226L possibly damaging Het
Fam193a C T 5: 34,462,131 P760L probably damaging Het
Gabra5 A T 7: 57,508,048 L6H probably benign Het
Gabrq G A X: 72,833,383 R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7334 T A 17: 50,698,978 D97E probably damaging Het
Gpsm1 G A 2: 26,325,383 A286T probably damaging Het
Gsta4 C A 9: 78,204,329 Y79* probably null Het
Hcn1 T A 13: 117,656,734 V174D probably benign Het
Hic1 G T 11: 75,165,794 C756* probably null Het
Hivep3 C T 4: 120,096,671 T728I probably benign Het
Ice1 T C 13: 70,604,442 E1175G possibly damaging Het
Igsf3 T A 3: 101,431,282 L304Q probably damaging Het
Kpna6 T C 4: 129,657,442 D90G probably benign Het
Krt73 C T 15: 101,793,928 G500D probably damaging Het
Lama3 A G 18: 12,402,062 K156E probably damaging Het
Mdm2 T C 10: 117,696,022 K94E probably damaging Het
Mitf T C 6: 97,941,099 S26P probably damaging Het
Myh4 C A 11: 67,256,295 Q1589K possibly damaging Het
Nlrp4c T A 7: 6,073,114 V671E probably benign Het
Nop9 C T 14: 55,752,134 A407V possibly damaging Het
Nrap T A 19: 56,335,042 H1366L probably damaging Het
Ntrk1 A T 3: 87,778,518 C766S probably damaging Het
Olfr625-ps1 A G 7: 103,682,861 N38D possibly damaging Het
Olfr768 T C 10: 129,093,747 I76V probably benign Het
Olfr845 A G 9: 19,338,858 T133A probably benign Het
Oog3 C T 4: 144,159,122 G302D possibly damaging Het
Pdzph1 C T 17: 58,973,752 V512I probably benign Het
Phf2 A C 13: 48,819,557 S408A unknown Het
Pigk T G 3: 152,740,156 L135V probably damaging Het
Ppp2ca C A 11: 52,121,946 T301N probably benign Het
Ppp4r3a A G 12: 101,058,482 S253P probably damaging Het
Ptgfrn A T 3: 101,050,122 I712N probably benign Het
Rapgef2 A T 3: 79,092,703 D579E probably damaging Het
Rims2 T A 15: 39,462,580 D769E probably damaging Het
Rptor T A 11: 119,725,061 C134S probably damaging Het
S100a1 A G 3: 90,511,292 F72L probably damaging Het
Scube1 T A 15: 83,721,945 D42V probably damaging Het
Sh3glb1 T C 3: 144,712,685 D39G probably damaging Het
Sh3pxd2a T C 19: 47,273,250 T397A probably benign Het
Siglece G A 7: 43,651,532 T453M probably damaging Het
Slc26a1 G A 5: 108,671,792 R514W probably damaging Het
Slc4a8 T C 15: 100,787,212 V156A probably benign Het
Smchd1 A T 17: 71,391,379 V1134E probably damaging Het
Sorbs2 A G 8: 45,770,576 Y222C probably damaging Het
Sorcs3 G T 19: 48,603,875 W326C possibly damaging Het
Taf2 A G 15: 55,071,397 V45A probably benign Het
Tiparp A T 3: 65,532,049 H80L probably damaging Het
Tmem71 T A 15: 66,541,699 T175S probably benign Het
Tmem87b T A 2: 128,839,170 V338D probably damaging Het
Trdn A G 10: 33,364,008 K445R probably damaging Het
Trim14 A G 4: 46,522,039 F213L probably benign Het
Tubgcp5 T A 7: 55,815,020 S550T probably benign Het
Tufm A G 7: 126,490,472 D446G probably benign Het
Vipr1 A T 9: 121,661,419 Y177F possibly damaging Het
Vmn2r116 A C 17: 23,401,766 I825L probably damaging Het
Vmn2r12 G T 5: 109,092,044 Q218K probably damaging Het
Vwa7 G T 17: 35,023,943 probably null Het
Ywhae T C 11: 75,755,665 V119A probably damaging Het
Zfand5 A G 19: 21,280,524 R199G probably damaging Het
Zfp810 T C 9: 22,278,532 Y360C possibly damaging Het
Zrsr1 A G 11: 22,973,637 D137G probably benign Het
Other mutations in Olfr735
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Olfr735 APN 14 50345614 missense probably damaging 0.99
IGL01655:Olfr735 APN 14 50346184 missense probably benign 0.01
IGL02838:Olfr735 APN 14 50345855 missense probably damaging 1.00
IGL02874:Olfr735 APN 14 50346126 missense probably damaging 1.00
R0609:Olfr735 UTSW 14 50345926 missense probably damaging 1.00
R0724:Olfr735 UTSW 14 50345917 missense possibly damaging 0.89
R0839:Olfr735 UTSW 14 50346088 missense probably damaging 0.98
R1799:Olfr735 UTSW 14 50346080 missense probably benign 0.32
R4934:Olfr735 UTSW 14 50345888 missense probably damaging 1.00
R5753:Olfr735 UTSW 14 50345588 missense probably damaging 0.96
R5996:Olfr735 UTSW 14 50345512 missense possibly damaging 0.89
R6555:Olfr735 UTSW 14 50345846 nonsense probably null
R6736:Olfr735 UTSW 14 50345448 missense probably damaging 1.00
R7841:Olfr735 UTSW 14 50345828 missense probably benign 0.09
R7922:Olfr735 UTSW 14 50346415 missense probably benign 0.03
R8190:Olfr735 UTSW 14 50345722 missense probably damaging 0.99
R8308:Olfr735 UTSW 14 50345465 missense probably benign 0.06
R8560:Olfr735 UTSW 14 50346337 missense probably benign 0.12
X0019:Olfr735 UTSW 14 50345806 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGAACATCTCACTGGCTCCAAG -3'
(R):5'- TGCATGGTACACGCAGACAAGC -3'

Sequencing Primer
(F):5'- AATACCTGGGCCAGGCATC -3'
(R):5'- TACACGCAGACAAGCAAGAAG -3'
Posted On2014-05-23