Incidental Mutation 'R1766:Taf2'
ID 194407
Institutional Source Beutler Lab
Gene Symbol Taf2
Ensembl Gene ENSMUSG00000037343
Gene Name TATA-box binding protein associated factor 2
Synonyms CIF150, 150kDa, TAF2B, 4732460C16Rik, TAFII150
MMRRC Submission 039798-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1766 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 55015131-55072152 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55071397 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 45 (V45A)
Ref Sequence ENSEMBL: ENSMUSP00000043733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023059] [ENSMUST00000041733] [ENSMUST00000110231]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000023059
SMART Domains Protein: ENSMUSP00000023059
Gene: ENSMUSG00000022422

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 48 364 7.3e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041733
AA Change: V45A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000043733
Gene: ENSMUSG00000037343
AA Change: V45A

DomainStartEndE-ValueType
Pfam:Peptidase_M1 21 406 5.6e-17 PFAM
SCOP:d1gw5a_ 606 973 6e-7 SMART
low complexity region 987 998 N/A INTRINSIC
low complexity region 1142 1175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110231
SMART Domains Protein: ENSMUSP00000105860
Gene: ENSMUSG00000022422

DomainStartEndE-ValueType
low complexity region 38 47 N/A INTRINSIC
Pfam:DUF2036 49 271 5.9e-62 PFAM
Pfam:DUF2036 284 426 4.3e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226864
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes one of the larger subunits of TFIID that is stably associated with the TFIID complex. It contributes to interactions at and downstream of the transcription initiation site, interactions that help determine transcription complex response to activators. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T C X: 112,241,085 (GRCm38) Y22H probably benign Het
Afg1l T C 10: 42,454,495 (GRCm38) T59A probably benign Het
Ankrd17 T A 5: 90,264,797 (GRCm38) M1223L possibly damaging Het
Ankrd24 G A 10: 81,638,638 (GRCm38) S68N probably benign Het
Arhgap31 A G 16: 38,625,590 (GRCm38) I131T probably damaging Het
Arhgef10 A T 8: 14,979,836 (GRCm38) I874F probably damaging Het
Arl5b T C 2: 15,069,837 (GRCm38) V43A probably benign Het
BC051665 G A 13: 60,785,040 (GRCm38) H36Y probably benign Het
Cdh9 A G 15: 16,778,306 (GRCm38) D69G probably damaging Het
Chd6 G A 2: 160,966,639 (GRCm38) L1552F probably damaging Het
Chrd A G 16: 20,737,441 (GRCm38) H584R probably damaging Het
Dnhd1 G A 7: 105,693,972 (GRCm38) V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 (GRCm38) G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 (GRCm38) probably null Het
Ehbp1l1 A G 19: 5,716,406 (GRCm38) V1303A probably damaging Het
Eif4e1b G A 13: 54,786,891 (GRCm38) E182K probably damaging Het
Fam170b A T 14: 32,835,886 (GRCm38) Q226L possibly damaging Het
Fam193a C T 5: 34,462,131 (GRCm38) P760L probably damaging Het
Gabra5 A T 7: 57,508,048 (GRCm38) L6H probably benign Het
Gabrq G A X: 72,833,383 (GRCm38) R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 (GRCm38) probably null Het
Gm7334 T A 17: 50,698,978 (GRCm38) D97E probably damaging Het
Gpsm1 G A 2: 26,325,383 (GRCm38) A286T probably damaging Het
Gsta4 C A 9: 78,204,329 (GRCm38) Y79* probably null Het
Hcn1 T A 13: 117,656,734 (GRCm38) V174D probably benign Het
Hic1 G T 11: 75,165,794 (GRCm38) C756* probably null Het
Hivep3 C T 4: 120,096,671 (GRCm38) T728I probably benign Het
Ice1 T C 13: 70,604,442 (GRCm38) E1175G possibly damaging Het
Igsf3 T A 3: 101,431,282 (GRCm38) L304Q probably damaging Het
Kpna6 T C 4: 129,657,442 (GRCm38) D90G probably benign Het
Krt73 C T 15: 101,793,928 (GRCm38) G500D probably damaging Het
Lama3 A G 18: 12,402,062 (GRCm38) K156E probably damaging Het
Mdm2 T C 10: 117,696,022 (GRCm38) K94E probably damaging Het
Mitf T C 6: 97,941,099 (GRCm38) S26P probably damaging Het
Myh4 C A 11: 67,256,295 (GRCm38) Q1589K possibly damaging Het
Nlrp4c T A 7: 6,073,114 (GRCm38) V671E probably benign Het
Nop9 C T 14: 55,752,134 (GRCm38) A407V possibly damaging Het
Nrap T A 19: 56,335,042 (GRCm38) H1366L probably damaging Het
Ntrk1 A T 3: 87,778,518 (GRCm38) C766S probably damaging Het
Olfr625-ps1 A G 7: 103,682,861 (GRCm38) N38D possibly damaging Het
Oog3 C T 4: 144,159,122 (GRCm38) G302D possibly damaging Het
Or4q3 T C 14: 50,346,220 (GRCm38) Y43C probably damaging Het
Or6c38 T C 10: 129,093,747 (GRCm38) I76V probably benign Het
Or7g27 A G 9: 19,338,858 (GRCm38) T133A probably benign Het
Pdzph1 C T 17: 58,973,752 (GRCm38) V512I probably benign Het
Phf2 A C 13: 48,819,557 (GRCm38) S408A unknown Het
Pigk T G 3: 152,740,156 (GRCm38) L135V probably damaging Het
Ppp2ca C A 11: 52,121,946 (GRCm38) T301N probably benign Het
Ppp4r3a A G 12: 101,058,482 (GRCm38) S253P probably damaging Het
Ptgfrn A T 3: 101,050,122 (GRCm38) I712N probably benign Het
Rapgef2 A T 3: 79,092,703 (GRCm38) D579E probably damaging Het
Rims2 T A 15: 39,462,580 (GRCm38) D769E probably damaging Het
Rptor T A 11: 119,725,061 (GRCm38) C134S probably damaging Het
S100a1 A G 3: 90,511,292 (GRCm38) F72L probably damaging Het
Scube1 T A 15: 83,721,945 (GRCm38) D42V probably damaging Het
Sh3glb1 T C 3: 144,712,685 (GRCm38) D39G probably damaging Het
Sh3pxd2a T C 19: 47,273,250 (GRCm38) T397A probably benign Het
Siglece G A 7: 43,651,532 (GRCm38) T453M probably damaging Het
Slc26a1 G A 5: 108,671,792 (GRCm38) R514W probably damaging Het
Slc4a8 T C 15: 100,787,212 (GRCm38) V156A probably benign Het
Smchd1 A T 17: 71,391,379 (GRCm38) V1134E probably damaging Het
Sorbs2 A G 8: 45,770,576 (GRCm38) Y222C probably damaging Het
Sorcs3 G T 19: 48,603,875 (GRCm38) W326C possibly damaging Het
Tiparp A T 3: 65,532,049 (GRCm38) H80L probably damaging Het
Tmem71 T A 15: 66,541,699 (GRCm38) T175S probably benign Het
Tmem87b T A 2: 128,839,170 (GRCm38) V338D probably damaging Het
Trdn A G 10: 33,364,008 (GRCm38) K445R probably damaging Het
Trim14 A G 4: 46,522,039 (GRCm38) F213L probably benign Het
Tubgcp5 T A 7: 55,815,020 (GRCm38) S550T probably benign Het
Tufm A G 7: 126,490,472 (GRCm38) D446G probably benign Het
Vipr1 A T 9: 121,661,419 (GRCm38) Y177F possibly damaging Het
Vmn2r116 A C 17: 23,401,766 (GRCm38) I825L probably damaging Het
Vmn2r12 G T 5: 109,092,044 (GRCm38) Q218K probably damaging Het
Vwa7 G T 17: 35,023,943 (GRCm38) probably null Het
Ywhae T C 11: 75,755,665 (GRCm38) V119A probably damaging Het
Zfand5 A G 19: 21,280,524 (GRCm38) R199G probably damaging Het
Zfp810 T C 9: 22,278,532 (GRCm38) Y360C possibly damaging Het
Zrsr2-ps1 A G 11: 22,973,637 (GRCm38) D137G probably benign Het
Other mutations in Taf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Taf2 APN 15 55,071,449 (GRCm38) critical splice acceptor site probably null
IGL00475:Taf2 APN 15 55,055,850 (GRCm38) nonsense probably null
IGL00549:Taf2 APN 15 55,031,115 (GRCm38) missense probably benign 0.03
IGL00839:Taf2 APN 15 55,045,778 (GRCm38) nonsense probably null
IGL01089:Taf2 APN 15 55,016,581 (GRCm38) missense probably benign
IGL01305:Taf2 APN 15 55,048,274 (GRCm38) missense probably damaging 0.99
IGL01532:Taf2 APN 15 55,049,486 (GRCm38) missense possibly damaging 0.94
IGL01903:Taf2 APN 15 55,060,016 (GRCm38) missense probably benign 0.03
IGL02324:Taf2 APN 15 55,028,376 (GRCm38) missense probably benign
IGL02328:Taf2 APN 15 55,028,376 (GRCm38) missense probably benign
IGL02405:Taf2 APN 15 55,034,155 (GRCm38) splice site probably benign
IGL02671:Taf2 APN 15 55,034,176 (GRCm38) missense probably benign 0.01
IGL02832:Taf2 APN 15 55,016,563 (GRCm38) missense probably benign 0.01
IGL03105:Taf2 APN 15 55,045,799 (GRCm38) missense probably benign 0.26
IGL03118:Taf2 APN 15 55,052,163 (GRCm38) missense probably damaging 1.00
ANU22:Taf2 UTSW 15 55,048,274 (GRCm38) missense probably damaging 0.99
R0104:Taf2 UTSW 15 55,038,338 (GRCm38) missense probably benign 0.02
R0104:Taf2 UTSW 15 55,038,338 (GRCm38) missense probably benign 0.02
R0183:Taf2 UTSW 15 55,055,790 (GRCm38) missense possibly damaging 0.89
R0326:Taf2 UTSW 15 55,047,460 (GRCm38) missense probably damaging 0.97
R0362:Taf2 UTSW 15 55,045,929 (GRCm38) missense probably damaging 1.00
R0423:Taf2 UTSW 15 55,064,682 (GRCm38) missense probably benign 0.02
R0562:Taf2 UTSW 15 55,022,188 (GRCm38) splice site probably benign
R0609:Taf2 UTSW 15 55,060,050 (GRCm38) missense probably damaging 1.00
R0655:Taf2 UTSW 15 55,038,294 (GRCm38) missense probably damaging 1.00
R0689:Taf2 UTSW 15 55,063,065 (GRCm38) missense possibly damaging 0.60
R0743:Taf2 UTSW 15 55,016,461 (GRCm38) small deletion probably benign
R0898:Taf2 UTSW 15 55,060,084 (GRCm38) missense probably damaging 0.97
R0969:Taf2 UTSW 15 55,031,157 (GRCm38) critical splice acceptor site probably null
R0974:Taf2 UTSW 15 55,016,461 (GRCm38) small deletion probably benign
R1145:Taf2 UTSW 15 55,016,461 (GRCm38) small deletion probably benign
R1145:Taf2 UTSW 15 55,016,461 (GRCm38) small deletion probably benign
R1160:Taf2 UTSW 15 55,071,397 (GRCm38) missense probably benign 0.01
R1376:Taf2 UTSW 15 55,016,461 (GRCm38) small deletion probably benign
R1388:Taf2 UTSW 15 55,036,625 (GRCm38) missense probably benign 0.00
R1416:Taf2 UTSW 15 55,038,410 (GRCm38) missense possibly damaging 0.95
R1458:Taf2 UTSW 15 55,059,915 (GRCm38) missense probably damaging 0.99
R1477:Taf2 UTSW 15 55,062,172 (GRCm38) missense possibly damaging 0.87
R1755:Taf2 UTSW 15 55,016,454 (GRCm38) missense probably damaging 1.00
R2090:Taf2 UTSW 15 55,016,486 (GRCm38) missense probably damaging 0.99
R2228:Taf2 UTSW 15 55,064,646 (GRCm38) missense possibly damaging 0.94
R2519:Taf2 UTSW 15 55,052,247 (GRCm38) missense probably benign 0.03
R4073:Taf2 UTSW 15 55,052,237 (GRCm38) missense probably damaging 1.00
R4470:Taf2 UTSW 15 55,058,880 (GRCm38) missense possibly damaging 0.70
R4471:Taf2 UTSW 15 55,058,880 (GRCm38) missense possibly damaging 0.70
R4472:Taf2 UTSW 15 55,058,880 (GRCm38) missense possibly damaging 0.70
R4716:Taf2 UTSW 15 55,065,968 (GRCm38) missense probably benign 0.02
R4937:Taf2 UTSW 15 55,027,223 (GRCm38) nonsense probably null
R5082:Taf2 UTSW 15 55,060,045 (GRCm38) missense probably benign 0.41
R5335:Taf2 UTSW 15 55,045,740 (GRCm38) missense probably benign 0.14
R5383:Taf2 UTSW 15 55,049,419 (GRCm38) missense possibly damaging 0.78
R5771:Taf2 UTSW 15 55,059,939 (GRCm38) missense probably benign 0.01
R5862:Taf2 UTSW 15 55,048,323 (GRCm38) missense possibly damaging 0.95
R5873:Taf2 UTSW 15 55,038,422 (GRCm38) missense probably benign 0.00
R5908:Taf2 UTSW 15 55,072,006 (GRCm38) unclassified probably benign
R6033:Taf2 UTSW 15 55,058,901 (GRCm38) missense probably damaging 1.00
R6033:Taf2 UTSW 15 55,058,901 (GRCm38) missense probably damaging 1.00
R6159:Taf2 UTSW 15 55,063,044 (GRCm38) missense possibly damaging 0.48
R6568:Taf2 UTSW 15 55,064,630 (GRCm38) missense probably damaging 1.00
R7094:Taf2 UTSW 15 55,060,086 (GRCm38) missense probably benign 0.27
R7174:Taf2 UTSW 15 55,048,739 (GRCm38) missense possibly damaging 0.51
R7241:Taf2 UTSW 15 55,062,141 (GRCm38) missense probably benign 0.01
R7561:Taf2 UTSW 15 55,055,833 (GRCm38) missense probably benign 0.16
R7583:Taf2 UTSW 15 55,064,676 (GRCm38) nonsense probably null
R7818:Taf2 UTSW 15 55,065,930 (GRCm38) missense probably benign
R7905:Taf2 UTSW 15 55,047,432 (GRCm38) missense possibly damaging 0.90
R8006:Taf2 UTSW 15 55,048,701 (GRCm38) missense probably damaging 1.00
R8017:Taf2 UTSW 15 55,064,617 (GRCm38) missense possibly damaging 0.66
R8019:Taf2 UTSW 15 55,064,617 (GRCm38) missense possibly damaging 0.66
R8119:Taf2 UTSW 15 55,031,130 (GRCm38) missense probably benign 0.00
R8127:Taf2 UTSW 15 55,059,988 (GRCm38) missense probably damaging 1.00
R8128:Taf2 UTSW 15 55,059,988 (GRCm38) missense probably damaging 1.00
R8129:Taf2 UTSW 15 55,059,988 (GRCm38) missense probably damaging 1.00
R8278:Taf2 UTSW 15 55,065,965 (GRCm38) nonsense probably null
R8290:Taf2 UTSW 15 55,063,020 (GRCm38) missense probably damaging 1.00
R8762:Taf2 UTSW 15 55,047,453 (GRCm38) missense probably benign 0.16
R8832:Taf2 UTSW 15 55,064,605 (GRCm38) missense possibly damaging 0.86
R8916:Taf2 UTSW 15 55,036,535 (GRCm38) missense probably benign 0.26
R8937:Taf2 UTSW 15 55,047,453 (GRCm38) missense probably benign 0.16
R9006:Taf2 UTSW 15 55,045,905 (GRCm38) missense possibly damaging 0.94
R9138:Taf2 UTSW 15 55,016,461 (GRCm38) small deletion probably benign
R9240:Taf2 UTSW 15 55,063,068 (GRCm38) missense probably null 1.00
R9257:Taf2 UTSW 15 55,066,013 (GRCm38) missense possibly damaging 0.46
R9485:Taf2 UTSW 15 55,048,271 (GRCm38) missense probably benign 0.05
R9762:Taf2 UTSW 15 55,031,044 (GRCm38) critical splice donor site probably null
R9766:Taf2 UTSW 15 55,047,485 (GRCm38) critical splice acceptor site probably null
R9796:Taf2 UTSW 15 55,047,436 (GRCm38) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTACAGGCTGTCCTGTCTAATGCAC -3'
(R):5'- CAAACCTTTTCATGGCTGTTGCTCG -3'

Sequencing Primer
(F):5'- CCTGTCTAATGCACAATGTGAAGG -3'
(R):5'- GGCTGTTGCTCGATTTAAAATAAGC -3'
Posted On 2014-05-23