Mutagenetix > Incidental Mutation

Incidental Mutation 'R1766:Scube1'

194409

Institutional Source

Beutler Lab

Gene Symbol

Scube1

Ensembl Gene

ENSMUSG00000016763

Gene Name

signal peptide, CUB domain, EGF-like 1

Synonyms

7330410C13Rik, A630023E24Rik

MMRRC Submission

039798-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.134) question?

Stock #

R1766 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83604999-83725021 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 83721945 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 42 (D42V)

Ref Sequence

ENSEMBL: ENSMUSP00000130131 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000016907] [ENSMUST00000043634] [ENSMUST00000076060] [ENSMUST00000171496]

AlphaFold

Q6NZL8

Predicted Effect

probably damaging
Transcript: ENSMUST00000016907
AA Change: D42V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000016907
Gene: ENSMUSG00000016763
AA Change: D42V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF_CA	33	73	1.5e-9	SMART
EGF_CA	74	116	7.29e-8	SMART
EGF_CA	117	157	1.4e-9	SMART
EGF	165	203	1.43e-1	SMART
EGF	205	242	1.09e1	SMART
EGF	274	311	1.69e-3	SMART
EGF_CA	312	352	2.13e-9	SMART
EGF_CA	353	391	4.7e-11	SMART
EGF_CA	392	432	3.91e-8	SMART
low complexity region	560	573	N/A	INTRINSIC
Pfam:GCC2_GCC3	666	713	4.5e-13	PFAM
EGF_like	766	804	6.81e1	SMART
CUB	828	940	1.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000043634
AA Change: D42V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044835
Gene: ENSMUSG00000016763
AA Change: D42V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF_CA	33	73	1.5e-9	SMART
EGF_CA	74	116	7.29e-8	SMART
EGF_CA	117	157	1.4e-9	SMART
EGF	163	200	1.69e-3	SMART
EGF_CA	201	241	2.13e-9	SMART
EGF_CA	242	280	4.7e-11	SMART
EGF_CA	281	321	3.91e-8	SMART
low complexity region	449	462	N/A	INTRINSIC
Pfam:GCC2_GCC3	555	602	3.2e-11	PFAM
EGF_like	655	693	6.81e1	SMART
CUB	717	829	1.51e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000076060
AA Change: D42V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075434
Gene: ENSMUSG00000016763
AA Change: D42V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF_CA	33	73	1.5e-9	SMART
EGF_CA	74	116	7.29e-8	SMART
EGF_CA	117	157	1.4e-9	SMART
EGF	165	203	1.43e-1	SMART
EGF	205	242	1.09e1	SMART
EGF	244	281	1.69e-3	SMART
EGF_CA	282	322	2.13e-9	SMART
EGF_CA	323	361	4.7e-11	SMART
EGF_CA	362	402	3.91e-8	SMART
low complexity region	530	543	N/A	INTRINSIC
Pfam:GCC2_GCC3	636	683	1.3e-11	PFAM
EGF_like	736	774	6.81e1	SMART
CUB	798	910	1.51e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144773

Predicted Effect

probably damaging
Transcript: ENSMUST00000171496
AA Change: D42V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000130131
Gene: ENSMUSG00000016763
AA Change: D42V

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF_CA	33	73	1.5e-9	SMART
EGF_CA	74	116	7.29e-8	SMART
EGF_CA	117	157	1.4e-9	SMART
EGF	165	203	1.43e-1	SMART
EGF	205	242	1.09e1	SMART
EGF	244	281	1.69e-3	SMART
EGF_CA	282	322	2.13e-9	SMART
EGF_CA	323	361	4.7e-11	SMART
EGF_CA	362	402	3.91e-8	SMART
low complexity region	530	543	N/A	INTRINSIC
Pfam:GCC2_GCC3	636	683	1.7e-11	PFAM
EGF_like	736	774	6.81e1	SMART
CUB	798	910	1.51e-19	SMART

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.3%
20x: 92.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface glycoprotein that is a member of the SCUBE (signal peptide, CUB domain, EGF (epidermal growth factor)-like protein) family. Family members have an amino-terminal signal peptide, nine copies of EGF-like repeats and a CUB domain at the carboxyl terminus. This protein is expressed in platelets and endothelial cells and may play an important role in vascular biology. [provided by RefSeq, Oct 2011]
PHENOTYPE: A fraction of homozygotes die neonatally with acrania and loss of brain tissue. Early skull bone defects include lack of the interparietal and supraoccipital bones and cranial vault. Affected mutant embryos show exencephaly, a thick-walled forebrain neuroepithelium and hyperplastic cranial ganglia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933403O08Rik	T	C	X: 112,241,085	Y22H	probably benign	Het
Afg1l	T	C	10: 42,454,495	T59A	probably benign	Het
Ankrd17	T	A	5: 90,264,797	M1223L	possibly damaging	Het
Ankrd24	G	A	10: 81,638,638	S68N	probably benign	Het
Arhgap31	A	G	16: 38,625,590	I131T	probably damaging	Het
Arhgef10	A	T	8: 14,979,836	I874F	probably damaging	Het
Arl5b	T	C	2: 15,069,837	V43A	probably benign	Het
BC051665	G	A	13: 60,785,040	H36Y	probably benign	Het
Cdh9	A	G	15: 16,778,306	D69G	probably damaging	Het
Chd6	G	A	2: 160,966,639	L1552F	probably damaging	Het
Chrd	A	G	16: 20,737,441	H584R	probably damaging	Het
Dnhd1	G	A	7: 105,693,972	V1508I	possibly damaging	Het
Dpy19l4	C	T	4: 11,303,360	G187D	probably damaging	Het
Dync2h1	T	C	9: 7,015,526		probably null	Het
Ehbp1l1	A	G	19: 5,716,406	V1303A	probably damaging	Het
Eif4e1b	G	A	13: 54,786,891	E182K	probably damaging	Het
Fam170b	A	T	14: 32,835,886	Q226L	possibly damaging	Het
Fam193a	C	T	5: 34,462,131	P760L	probably damaging	Het
Gabra5	A	T	7: 57,508,048	L6H	probably benign	Het
Gabrq	G	A	X: 72,833,383	R161H	probably damaging	Het
Gm10608	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA	9: 119,160,716		probably null	Het
Gm7334	T	A	17: 50,698,978	D97E	probably damaging	Het
Gpsm1	G	A	2: 26,325,383	A286T	probably damaging	Het
Gsta4	C	A	9: 78,204,329	Y79*	probably null	Het
Hcn1	T	A	13: 117,656,734	V174D	probably benign	Het
Hic1	G	T	11: 75,165,794	C756*	probably null	Het
Hivep3	C	T	4: 120,096,671	T728I	probably benign	Het
Ice1	T	C	13: 70,604,442	E1175G	possibly damaging	Het
Igsf3	T	A	3: 101,431,282	L304Q	probably damaging	Het
Kpna6	T	C	4: 129,657,442	D90G	probably benign	Het
Krt73	C	T	15: 101,793,928	G500D	probably damaging	Het
Lama3	A	G	18: 12,402,062	K156E	probably damaging	Het
Mdm2	T	C	10: 117,696,022	K94E	probably damaging	Het
Mitf	T	C	6: 97,941,099	S26P	probably damaging	Het
Myh4	C	A	11: 67,256,295	Q1589K	possibly damaging	Het
Nlrp4c	T	A	7: 6,073,114	V671E	probably benign	Het
Nop9	C	T	14: 55,752,134	A407V	possibly damaging	Het
Nrap	T	A	19: 56,335,042	H1366L	probably damaging	Het
Ntrk1	A	T	3: 87,778,518	C766S	probably damaging	Het
Olfr625-ps1	A	G	7: 103,682,861	N38D	possibly damaging	Het
Olfr735	T	C	14: 50,346,220	Y43C	probably damaging	Het
Olfr768	T	C	10: 129,093,747	I76V	probably benign	Het
Olfr845	A	G	9: 19,338,858	T133A	probably benign	Het
Oog3	C	T	4: 144,159,122	G302D	possibly damaging	Het
Pdzph1	C	T	17: 58,973,752	V512I	probably benign	Het
Phf2	A	C	13: 48,819,557	S408A	unknown	Het
Pigk	T	G	3: 152,740,156	L135V	probably damaging	Het
Ppp2ca	C	A	11: 52,121,946	T301N	probably benign	Het
Ppp4r3a	A	G	12: 101,058,482	S253P	probably damaging	Het
Ptgfrn	A	T	3: 101,050,122	I712N	probably benign	Het
Rapgef2	A	T	3: 79,092,703	D579E	probably damaging	Het
Rims2	T	A	15: 39,462,580	D769E	probably damaging	Het
Rptor	T	A	11: 119,725,061	C134S	probably damaging	Het
S100a1	A	G	3: 90,511,292	F72L	probably damaging	Het
Sh3glb1	T	C	3: 144,712,685	D39G	probably damaging	Het
Sh3pxd2a	T	C	19: 47,273,250	T397A	probably benign	Het
Siglece	G	A	7: 43,651,532	T453M	probably damaging	Het
Slc26a1	G	A	5: 108,671,792	R514W	probably damaging	Het
Slc4a8	T	C	15: 100,787,212	V156A	probably benign	Het
Smchd1	A	T	17: 71,391,379	V1134E	probably damaging	Het
Sorbs2	A	G	8: 45,770,576	Y222C	probably damaging	Het
Sorcs3	G	T	19: 48,603,875	W326C	possibly damaging	Het
Taf2	A	G	15: 55,071,397	V45A	probably benign	Het
Tiparp	A	T	3: 65,532,049	H80L	probably damaging	Het
Tmem71	T	A	15: 66,541,699	T175S	probably benign	Het
Tmem87b	T	A	2: 128,839,170	V338D	probably damaging	Het
Trdn	A	G	10: 33,364,008	K445R	probably damaging	Het
Trim14	A	G	4: 46,522,039	F213L	probably benign	Het
Tubgcp5	T	A	7: 55,815,020	S550T	probably benign	Het
Tufm	A	G	7: 126,490,472	D446G	probably benign	Het
Vipr1	A	T	9: 121,661,419	Y177F	possibly damaging	Het
Vmn2r116	A	C	17: 23,401,766	I825L	probably damaging	Het
Vmn2r12	G	T	5: 109,092,044	Q218K	probably damaging	Het
Vwa7	G	T	17: 35,023,943		probably null	Het
Ywhae	T	C	11: 75,755,665	V119A	probably damaging	Het
Zfand5	A	G	19: 21,280,524	R199G	probably damaging	Het
Zfp810	T	C	9: 22,278,532	Y360C	possibly damaging	Het
Zrsr1	A	G	11: 22,973,637	D137G	probably benign	Het

Other mutations in Scube1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00903:Scube1	APN	15	83703501	missense	probably damaging	0.98
IGL01152:Scube1	APN	15	83613570	missense	probably damaging	1.00
IGL01388:Scube1	APN	15	83620131	missense	probably benign	0.00
IGL01589:Scube1	APN	15	83612553	missense	probably damaging	1.00
IGL02208:Scube1	APN	15	83703540	missense	probably damaging	1.00
IGL02305:Scube1	APN	15	83607390	missense	probably damaging	1.00
IGL02728:Scube1	APN	15	83659016	splice site	probably benign
IGL02737:Scube1	APN	15	83721843	splice site	probably benign
IGL03326:Scube1	APN	15	83607416	missense	probably damaging	1.00
R0055:Scube1	UTSW	15	83634736	missense	probably damaging	1.00
R0055:Scube1	UTSW	15	83634736	missense	probably damaging	1.00
R0126:Scube1	UTSW	15	83621063	missense	probably damaging	1.00
R0792:Scube1	UTSW	15	83628076	critical splice acceptor site	probably null
R1438:Scube1	UTSW	15	83615026	missense	possibly damaging	0.93
R1522:Scube1	UTSW	15	83628076	critical splice acceptor site	probably null
R1735:Scube1	UTSW	15	83607437	missense	probably damaging	1.00
R1778:Scube1	UTSW	15	83610204	missense	probably damaging	1.00
R2975:Scube1	UTSW	15	83659098	missense	probably damaging	0.99
R4080:Scube1	UTSW	15	83608747	missense	probably damaging	1.00
R4434:Scube1	UTSW	15	83721924	missense	probably damaging	1.00
R5585:Scube1	UTSW	15	83676923	missense	probably damaging	1.00
R5857:Scube1	UTSW	15	83607260	unclassified	probably benign
R5977:Scube1	UTSW	15	83629488	missense	probably damaging	1.00
R6054:Scube1	UTSW	15	83651676	missense	probably benign	0.43
R6461:Scube1	UTSW	15	83612427	missense	probably damaging	1.00
R6956:Scube1	UTSW	15	83721876	missense	probably damaging	1.00
R6959:Scube1	UTSW	15	83629435	missense	probably benign	0.42
R7124:Scube1	UTSW	15	83629511	splice site	probably null
R7267:Scube1	UTSW	15	83621065	missense	probably damaging	1.00
R7404:Scube1	UTSW	15	83615010	missense	probably damaging	0.98
R7584:Scube1	UTSW	15	83721887	nonsense	probably null
R7585:Scube1	UTSW	15	83638787	missense	possibly damaging	0.83
R7599:Scube1	UTSW	15	83613452	missense	probably damaging	1.00
R8055:Scube1	UTSW	15	83659025	critical splice donor site	probably null
R8098:Scube1	UTSW	15	83659088	missense	probably damaging	1.00
R8192:Scube1	UTSW	15	83629382	critical splice donor site	probably null
R8394:Scube1	UTSW	15	83608291	missense	probably damaging	1.00
R8441:Scube1	UTSW	15	83610222	missense	probably damaging	0.99
R8713:Scube1	UTSW	15	83610270	missense	possibly damaging	0.58
R8844:Scube1	UTSW	15	83676963	missense	probably damaging	1.00
R9090:Scube1	UTSW	15	83610193	missense	probably damaging	1.00
R9169:Scube1	UTSW	15	83659097	missense	possibly damaging	0.88
R9271:Scube1	UTSW	15	83610193	missense	probably damaging	1.00
R9334:Scube1	UTSW	15	83628063	missense	possibly damaging	0.72
R9363:Scube1	UTSW	15	83614879	nonsense	probably null
R9534:Scube1	UTSW	15	83721901	missense	probably damaging	1.00
R9569:Scube1	UTSW	15	83629404	missense	probably damaging	1.00
R9574:Scube1	UTSW	15	83616799	missense
R9759:Scube1	UTSW	15	83608264	missense	probably benign	0.02
R9788:Scube1	UTSW	15	83651700	missense	possibly damaging	0.73
X0022:Scube1	UTSW	15	83634669	critical splice donor site	probably null
Z1177:Scube1	UTSW	15	83612416	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATTGACAGAAGCCCGAACTGCC -3'
(R):5'- AGTTTTCCAATCTGCCACCCTGAG -3'

Sequencing Primer
(F):5'- GAACTGCCCATGTTCACAGG -3'
(R):5'- gaaaataaagaccagatgtgaggag -3'

Posted On

2014-05-23