Incidental Mutation 'R1766:Scube1'
ID194409
Institutional Source Beutler Lab
Gene Symbol Scube1
Ensembl Gene ENSMUSG00000016763
Gene Namesignal peptide, CUB domain, EGF-like 1
Synonyms7330410C13Rik, A630023E24Rik
MMRRC Submission 039798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.227) question?
Stock #R1766 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location83604999-83725021 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83721945 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 42 (D42V)
Ref Sequence ENSEMBL: ENSMUSP00000130131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016907] [ENSMUST00000043634] [ENSMUST00000076060] [ENSMUST00000171496]
Predicted Effect probably damaging
Transcript: ENSMUST00000016907
AA Change: D42V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016907
Gene: ENSMUSG00000016763
AA Change: D42V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 274 311 1.69e-3 SMART
EGF_CA 312 352 2.13e-9 SMART
EGF_CA 353 391 4.7e-11 SMART
EGF_CA 392 432 3.91e-8 SMART
low complexity region 560 573 N/A INTRINSIC
Pfam:GCC2_GCC3 666 713 4.5e-13 PFAM
EGF_like 766 804 6.81e1 SMART
CUB 828 940 1.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043634
AA Change: D42V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044835
Gene: ENSMUSG00000016763
AA Change: D42V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 163 200 1.69e-3 SMART
EGF_CA 201 241 2.13e-9 SMART
EGF_CA 242 280 4.7e-11 SMART
EGF_CA 281 321 3.91e-8 SMART
low complexity region 449 462 N/A INTRINSIC
Pfam:GCC2_GCC3 555 602 3.2e-11 PFAM
EGF_like 655 693 6.81e1 SMART
CUB 717 829 1.51e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076060
AA Change: D42V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075434
Gene: ENSMUSG00000016763
AA Change: D42V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.3e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144773
Predicted Effect probably damaging
Transcript: ENSMUST00000171496
AA Change: D42V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130131
Gene: ENSMUSG00000016763
AA Change: D42V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
EGF_CA 33 73 1.5e-9 SMART
EGF_CA 74 116 7.29e-8 SMART
EGF_CA 117 157 1.4e-9 SMART
EGF 165 203 1.43e-1 SMART
EGF 205 242 1.09e1 SMART
EGF 244 281 1.69e-3 SMART
EGF_CA 282 322 2.13e-9 SMART
EGF_CA 323 361 4.7e-11 SMART
EGF_CA 362 402 3.91e-8 SMART
low complexity region 530 543 N/A INTRINSIC
Pfam:GCC2_GCC3 636 683 1.7e-11 PFAM
EGF_like 736 774 6.81e1 SMART
CUB 798 910 1.51e-19 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface glycoprotein that is a member of the SCUBE (signal peptide, CUB domain, EGF (epidermal growth factor)-like protein) family. Family members have an amino-terminal signal peptide, nine copies of EGF-like repeats and a CUB domain at the carboxyl terminus. This protein is expressed in platelets and endothelial cells and may play an important role in vascular biology. [provided by RefSeq, Oct 2011]
PHENOTYPE: A fraction of homozygotes die neonatally with acrania and loss of brain tissue. Early skull bone defects include lack of the interparietal and supraoccipital bones and cranial vault. Affected mutant embryos show exencephaly, a thick-walled forebrain neuroepithelium and hyperplastic cranial ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T C X: 112,241,085 Y22H probably benign Het
Afg1l T C 10: 42,454,495 T59A probably benign Het
Ankrd17 T A 5: 90,264,797 M1223L possibly damaging Het
Ankrd24 G A 10: 81,638,638 S68N probably benign Het
Arhgap31 A G 16: 38,625,590 I131T probably damaging Het
Arhgef10 A T 8: 14,979,836 I874F probably damaging Het
Arl5b T C 2: 15,069,837 V43A probably benign Het
BC051665 G A 13: 60,785,040 H36Y probably benign Het
Cdh9 A G 15: 16,778,306 D69G probably damaging Het
Chd6 G A 2: 160,966,639 L1552F probably damaging Het
Chrd A G 16: 20,737,441 H584R probably damaging Het
Dnhd1 G A 7: 105,693,972 V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 probably null Het
Ehbp1l1 A G 19: 5,716,406 V1303A probably damaging Het
Eif4e1b G A 13: 54,786,891 E182K probably damaging Het
Fam170b A T 14: 32,835,886 Q226L possibly damaging Het
Fam193a C T 5: 34,462,131 P760L probably damaging Het
Gabra5 A T 7: 57,508,048 L6H probably benign Het
Gabrq G A X: 72,833,383 R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7334 T A 17: 50,698,978 D97E probably damaging Het
Gpsm1 G A 2: 26,325,383 A286T probably damaging Het
Gsta4 C A 9: 78,204,329 Y79* probably null Het
Hcn1 T A 13: 117,656,734 V174D probably benign Het
Hic1 G T 11: 75,165,794 C756* probably null Het
Hivep3 C T 4: 120,096,671 T728I probably benign Het
Ice1 T C 13: 70,604,442 E1175G possibly damaging Het
Igsf3 T A 3: 101,431,282 L304Q probably damaging Het
Kpna6 T C 4: 129,657,442 D90G probably benign Het
Krt73 C T 15: 101,793,928 G500D probably damaging Het
Lama3 A G 18: 12,402,062 K156E probably damaging Het
Mdm2 T C 10: 117,696,022 K94E probably damaging Het
Mitf T C 6: 97,941,099 S26P probably damaging Het
Myh4 C A 11: 67,256,295 Q1589K possibly damaging Het
Nlrp4c T A 7: 6,073,114 V671E probably benign Het
Nop9 C T 14: 55,752,134 A407V possibly damaging Het
Nrap T A 19: 56,335,042 H1366L probably damaging Het
Ntrk1 A T 3: 87,778,518 C766S probably damaging Het
Olfr625-ps1 A G 7: 103,682,861 N38D possibly damaging Het
Olfr735 T C 14: 50,346,220 Y43C probably damaging Het
Olfr768 T C 10: 129,093,747 I76V probably benign Het
Olfr845 A G 9: 19,338,858 T133A probably benign Het
Oog3 C T 4: 144,159,122 G302D possibly damaging Het
Pdzph1 C T 17: 58,973,752 V512I probably benign Het
Phf2 A C 13: 48,819,557 S408A unknown Het
Pigk T G 3: 152,740,156 L135V probably damaging Het
Ppp2ca C A 11: 52,121,946 T301N probably benign Het
Ppp4r3a A G 12: 101,058,482 S253P probably damaging Het
Ptgfrn A T 3: 101,050,122 I712N probably benign Het
Rapgef2 A T 3: 79,092,703 D579E probably damaging Het
Rims2 T A 15: 39,462,580 D769E probably damaging Het
Rptor T A 11: 119,725,061 C134S probably damaging Het
S100a1 A G 3: 90,511,292 F72L probably damaging Het
Sh3glb1 T C 3: 144,712,685 D39G probably damaging Het
Sh3pxd2a T C 19: 47,273,250 T397A probably benign Het
Siglece G A 7: 43,651,532 T453M probably damaging Het
Slc26a1 G A 5: 108,671,792 R514W probably damaging Het
Slc4a8 T C 15: 100,787,212 V156A probably benign Het
Smchd1 A T 17: 71,391,379 V1134E probably damaging Het
Sorbs2 A G 8: 45,770,576 Y222C probably damaging Het
Sorcs3 G T 19: 48,603,875 W326C possibly damaging Het
Taf2 A G 15: 55,071,397 V45A probably benign Het
Tiparp A T 3: 65,532,049 H80L probably damaging Het
Tmem71 T A 15: 66,541,699 T175S probably benign Het
Tmem87b T A 2: 128,839,170 V338D probably damaging Het
Trdn A G 10: 33,364,008 K445R probably damaging Het
Trim14 A G 4: 46,522,039 F213L probably benign Het
Tubgcp5 T A 7: 55,815,020 S550T probably benign Het
Tufm A G 7: 126,490,472 D446G probably benign Het
Vipr1 A T 9: 121,661,419 Y177F possibly damaging Het
Vmn2r116 A C 17: 23,401,766 I825L probably damaging Het
Vmn2r12 G T 5: 109,092,044 Q218K probably damaging Het
Vwa7 G T 17: 35,023,943 probably null Het
Ywhae T C 11: 75,755,665 V119A probably damaging Het
Zfand5 A G 19: 21,280,524 R199G probably damaging Het
Zfp810 T C 9: 22,278,532 Y360C possibly damaging Het
Zrsr1 A G 11: 22,973,637 D137G probably benign Het
Other mutations in Scube1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00903:Scube1 APN 15 83703501 missense probably damaging 0.98
IGL01152:Scube1 APN 15 83613570 missense probably damaging 1.00
IGL01388:Scube1 APN 15 83620131 missense probably benign 0.00
IGL01589:Scube1 APN 15 83612553 missense probably damaging 1.00
IGL02208:Scube1 APN 15 83703540 missense probably damaging 1.00
IGL02305:Scube1 APN 15 83607390 missense probably damaging 1.00
IGL02728:Scube1 APN 15 83659016 splice site probably benign
IGL02737:Scube1 APN 15 83721843 splice site probably benign
IGL03326:Scube1 APN 15 83607416 missense probably damaging 1.00
R0055:Scube1 UTSW 15 83634736 missense probably damaging 1.00
R0055:Scube1 UTSW 15 83634736 missense probably damaging 1.00
R0126:Scube1 UTSW 15 83621063 missense probably damaging 1.00
R0792:Scube1 UTSW 15 83628076 critical splice acceptor site probably null
R1438:Scube1 UTSW 15 83615026 missense possibly damaging 0.93
R1522:Scube1 UTSW 15 83628076 critical splice acceptor site probably null
R1735:Scube1 UTSW 15 83607437 missense probably damaging 1.00
R1778:Scube1 UTSW 15 83610204 missense probably damaging 1.00
R2975:Scube1 UTSW 15 83659098 missense probably damaging 0.99
R4080:Scube1 UTSW 15 83608747 missense probably damaging 1.00
R4434:Scube1 UTSW 15 83721924 missense probably damaging 1.00
R5585:Scube1 UTSW 15 83676923 missense probably damaging 1.00
R5857:Scube1 UTSW 15 83607260 unclassified probably benign
R5977:Scube1 UTSW 15 83629488 missense probably damaging 1.00
R6054:Scube1 UTSW 15 83651676 missense probably benign 0.43
R6461:Scube1 UTSW 15 83612427 missense probably damaging 1.00
R6956:Scube1 UTSW 15 83721876 missense probably damaging 1.00
R6959:Scube1 UTSW 15 83629435 missense probably benign 0.42
R7124:Scube1 UTSW 15 83629511 splice site probably null
R7267:Scube1 UTSW 15 83621065 missense probably damaging 1.00
R7404:Scube1 UTSW 15 83615010 missense probably damaging 0.98
R7584:Scube1 UTSW 15 83721887 nonsense probably null
R7585:Scube1 UTSW 15 83638787 missense possibly damaging 0.83
R7599:Scube1 UTSW 15 83613452 missense probably damaging 1.00
R8055:Scube1 UTSW 15 83659025 critical splice donor site probably null
R8098:Scube1 UTSW 15 83659088 missense probably damaging 1.00
R8192:Scube1 UTSW 15 83629382 critical splice donor site probably null
R8394:Scube1 UTSW 15 83608291 missense probably damaging 1.00
R8441:Scube1 UTSW 15 83610222 missense probably damaging 0.99
R8713:Scube1 UTSW 15 83610270 missense possibly damaging 0.58
R8844:Scube1 UTSW 15 83676963 missense probably damaging 1.00
X0022:Scube1 UTSW 15 83634669 critical splice donor site probably null
Z1177:Scube1 UTSW 15 83612416 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTGACAGAAGCCCGAACTGCC -3'
(R):5'- AGTTTTCCAATCTGCCACCCTGAG -3'

Sequencing Primer
(F):5'- GAACTGCCCATGTTCACAGG -3'
(R):5'- gaaaataaagaccagatgtgaggag -3'
Posted On2014-05-23