Incidental Mutation 'R1766:Slc4a8'
ID194410
Institutional Source Beutler Lab
Gene Symbol Slc4a8
Ensembl Gene ENSMUSG00000023032
Gene Namesolute carrier family 4 (anion exchanger), member 8
SynonymsNDCBE, KNBC-3, sodium bicarbonate cotransporter isoform 3 kNBC-3
MMRRC Submission 039798-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R1766 (G1)
Quality Score216
Status Not validated
Chromosome15
Chromosomal Location100761747-100823968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100787212 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 156 (V156A)
Ref Sequence ENSEMBL: ENSMUSP00000125090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023776] [ENSMUST00000162049]
Predicted Effect probably benign
Transcript: ENSMUST00000023776
AA Change: V208A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023776
Gene: ENSMUSG00000023032
AA Change: V208A

DomainStartEndE-ValueType
low complexity region 60 79 N/A INTRINSIC
Pfam:Band_3_cyto 145 402 1.4e-105 PFAM
Pfam:HCO3_cotransp 443 956 9.6e-247 PFAM
transmembrane domain 964 986 N/A INTRINSIC
low complexity region 1010 1027 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162049
AA Change: V156A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125090
Gene: ENSMUSG00000023032
AA Change: V156A

DomainStartEndE-ValueType
low complexity region 8 27 N/A INTRINSIC
Pfam:Band_3_cyto 93 350 6.5e-103 PFAM
Pfam:HCO3_cotransp 390 904 1.6e-251 PFAM
transmembrane domain 912 934 N/A INTRINSIC
low complexity region 958 975 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that functions to transport sodium and bicarbonate ions across the cell membrane. The encoded protein is important for pH regulation in neurons. The activity of this protein can be inhibited by 4,4'-Di-isothiocyanatostilbene-2,2'-disulfonic acid (DIDS). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal sodium and chloride ion excretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T C X: 112,241,085 Y22H probably benign Het
Afg1l T C 10: 42,454,495 T59A probably benign Het
Ankrd17 T A 5: 90,264,797 M1223L possibly damaging Het
Ankrd24 G A 10: 81,638,638 S68N probably benign Het
Arhgap31 A G 16: 38,625,590 I131T probably damaging Het
Arhgef10 A T 8: 14,979,836 I874F probably damaging Het
Arl5b T C 2: 15,069,837 V43A probably benign Het
BC051665 G A 13: 60,785,040 H36Y probably benign Het
Cdh9 A G 15: 16,778,306 D69G probably damaging Het
Chd6 G A 2: 160,966,639 L1552F probably damaging Het
Chrd A G 16: 20,737,441 H584R probably damaging Het
Dnhd1 G A 7: 105,693,972 V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 probably null Het
Ehbp1l1 A G 19: 5,716,406 V1303A probably damaging Het
Eif4e1b G A 13: 54,786,891 E182K probably damaging Het
Fam170b A T 14: 32,835,886 Q226L possibly damaging Het
Fam193a C T 5: 34,462,131 P760L probably damaging Het
Gabra5 A T 7: 57,508,048 L6H probably benign Het
Gabrq G A X: 72,833,383 R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7334 T A 17: 50,698,978 D97E probably damaging Het
Gpsm1 G A 2: 26,325,383 A286T probably damaging Het
Gsta4 C A 9: 78,204,329 Y79* probably null Het
Hcn1 T A 13: 117,656,734 V174D probably benign Het
Hic1 G T 11: 75,165,794 C756* probably null Het
Hivep3 C T 4: 120,096,671 T728I probably benign Het
Ice1 T C 13: 70,604,442 E1175G possibly damaging Het
Igsf3 T A 3: 101,431,282 L304Q probably damaging Het
Kpna6 T C 4: 129,657,442 D90G probably benign Het
Krt73 C T 15: 101,793,928 G500D probably damaging Het
Lama3 A G 18: 12,402,062 K156E probably damaging Het
Mdm2 T C 10: 117,696,022 K94E probably damaging Het
Mitf T C 6: 97,941,099 S26P probably damaging Het
Myh4 C A 11: 67,256,295 Q1589K possibly damaging Het
Nlrp4c T A 7: 6,073,114 V671E probably benign Het
Nop9 C T 14: 55,752,134 A407V possibly damaging Het
Nrap T A 19: 56,335,042 H1366L probably damaging Het
Ntrk1 A T 3: 87,778,518 C766S probably damaging Het
Olfr625-ps1 A G 7: 103,682,861 N38D possibly damaging Het
Olfr735 T C 14: 50,346,220 Y43C probably damaging Het
Olfr768 T C 10: 129,093,747 I76V probably benign Het
Olfr845 A G 9: 19,338,858 T133A probably benign Het
Oog3 C T 4: 144,159,122 G302D possibly damaging Het
Pdzph1 C T 17: 58,973,752 V512I probably benign Het
Phf2 A C 13: 48,819,557 S408A unknown Het
Pigk T G 3: 152,740,156 L135V probably damaging Het
Ppp2ca C A 11: 52,121,946 T301N probably benign Het
Ppp4r3a A G 12: 101,058,482 S253P probably damaging Het
Ptgfrn A T 3: 101,050,122 I712N probably benign Het
Rapgef2 A T 3: 79,092,703 D579E probably damaging Het
Rims2 T A 15: 39,462,580 D769E probably damaging Het
Rptor T A 11: 119,725,061 C134S probably damaging Het
S100a1 A G 3: 90,511,292 F72L probably damaging Het
Scube1 T A 15: 83,721,945 D42V probably damaging Het
Sh3glb1 T C 3: 144,712,685 D39G probably damaging Het
Sh3pxd2a T C 19: 47,273,250 T397A probably benign Het
Siglece G A 7: 43,651,532 T453M probably damaging Het
Slc26a1 G A 5: 108,671,792 R514W probably damaging Het
Smchd1 A T 17: 71,391,379 V1134E probably damaging Het
Sorbs2 A G 8: 45,770,576 Y222C probably damaging Het
Sorcs3 G T 19: 48,603,875 W326C possibly damaging Het
Taf2 A G 15: 55,071,397 V45A probably benign Het
Tiparp A T 3: 65,532,049 H80L probably damaging Het
Tmem71 T A 15: 66,541,699 T175S probably benign Het
Tmem87b T A 2: 128,839,170 V338D probably damaging Het
Trdn A G 10: 33,364,008 K445R probably damaging Het
Trim14 A G 4: 46,522,039 F213L probably benign Het
Tubgcp5 T A 7: 55,815,020 S550T probably benign Het
Tufm A G 7: 126,490,472 D446G probably benign Het
Vipr1 A T 9: 121,661,419 Y177F possibly damaging Het
Vmn2r116 A C 17: 23,401,766 I825L probably damaging Het
Vmn2r12 G T 5: 109,092,044 Q218K probably damaging Het
Vwa7 G T 17: 35,023,943 probably null Het
Ywhae T C 11: 75,755,665 V119A probably damaging Het
Zfand5 A G 19: 21,280,524 R199G probably damaging Het
Zfp810 T C 9: 22,278,532 Y360C possibly damaging Het
Zrsr1 A G 11: 22,973,637 D137G probably benign Het
Other mutations in Slc4a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Slc4a8 APN 15 100807438 missense possibly damaging 0.50
IGL01633:Slc4a8 APN 15 100787247 missense probably damaging 1.00
IGL02945:Slc4a8 APN 15 100807199 critical splice acceptor site probably null
IGL03172:Slc4a8 APN 15 100799717 missense probably benign
R0008:Slc4a8 UTSW 15 100800493 missense possibly damaging 0.67
R0040:Slc4a8 UTSW 15 100789846 missense probably damaging 0.98
R0040:Slc4a8 UTSW 15 100789846 missense probably damaging 0.98
R0257:Slc4a8 UTSW 15 100784880 splice site probably benign
R0393:Slc4a8 UTSW 15 100774638 missense probably damaging 0.99
R0508:Slc4a8 UTSW 15 100789092 missense probably benign 0.01
R0639:Slc4a8 UTSW 15 100796550 missense probably damaging 1.00
R1640:Slc4a8 UTSW 15 100783787 missense probably benign 0.13
R1692:Slc4a8 UTSW 15 100800573 missense probably damaging 1.00
R1955:Slc4a8 UTSW 15 100807376 missense probably damaging 1.00
R2157:Slc4a8 UTSW 15 100806373 missense probably damaging 1.00
R2206:Slc4a8 UTSW 15 100807445 missense probably damaging 1.00
R2229:Slc4a8 UTSW 15 100809299 missense probably damaging 1.00
R2274:Slc4a8 UTSW 15 100807402 missense probably benign 0.00
R2275:Slc4a8 UTSW 15 100807402 missense probably benign 0.00
R4299:Slc4a8 UTSW 15 100796640 critical splice donor site probably null
R4482:Slc4a8 UTSW 15 100810599 missense probably damaging 1.00
R5038:Slc4a8 UTSW 15 100795821 missense probably damaging 0.98
R5586:Slc4a8 UTSW 15 100787164 missense probably damaging 1.00
R5594:Slc4a8 UTSW 15 100795887 missense probably damaging 1.00
R5804:Slc4a8 UTSW 15 100791625 missense possibly damaging 0.71
R5815:Slc4a8 UTSW 15 100788211 missense probably benign 0.42
R5921:Slc4a8 UTSW 15 100814447 splice site probably benign
R6029:Slc4a8 UTSW 15 100807339 missense probably benign 0.00
R6212:Slc4a8 UTSW 15 100811571 missense possibly damaging 0.69
R6321:Slc4a8 UTSW 15 100789164 missense probably damaging 0.99
R6574:Slc4a8 UTSW 15 100807316 missense probably damaging 1.00
R6829:Slc4a8 UTSW 15 100800538 missense probably damaging 1.00
R7023:Slc4a8 UTSW 15 100791643 missense probably benign 0.00
R7082:Slc4a8 UTSW 15 100791027 missense probably damaging 1.00
R7197:Slc4a8 UTSW 15 100790976 missense probably damaging 1.00
R7352:Slc4a8 UTSW 15 100790984 missense probably damaging 1.00
R7391:Slc4a8 UTSW 15 100784862 missense probably damaging 0.98
R7627:Slc4a8 UTSW 15 100788223 missense probably benign 0.08
R7810:Slc4a8 UTSW 15 100798178 missense possibly damaging 0.72
R8026:Slc4a8 UTSW 15 100787289 missense possibly damaging 0.72
Z1088:Slc4a8 UTSW 15 100761951 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGGGCTGCATTCCTCAAAGGC -3'
(R):5'- CTTTCTGAGAGCACAAGTGGGAGAC -3'

Sequencing Primer
(F):5'- tcagaaatccgcctgcc -3'
(R):5'- ACCCACCAAAGAGATGTAGTG -3'
Posted On2014-05-23