Incidental Mutation 'R1766:Chrd'
ID 194413
Institutional Source Beutler Lab
Gene Symbol Chrd
Ensembl Gene ENSMUSG00000006958
Gene Name chordin
Synonyms Chd
MMRRC Submission 039798-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1766 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 20551877-20561134 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20556191 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 584 (H584R)
Ref Sequence ENSEMBL: ENSMUSP00000156080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007171] [ENSMUST00000115423] [ENSMUST00000115437] [ENSMUST00000153299] [ENSMUST00000231636] [ENSMUST00000232646] [ENSMUST00000231698]
AlphaFold Q9Z0E2
Predicted Effect probably damaging
Transcript: ENSMUST00000007171
AA Change: H562R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000007171
Gene: ENSMUSG00000006958
AA Change: H562R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 643 2.03e-31 SMART
low complexity region 676 687 N/A INTRINSIC
VWC 701 758 4.69e-10 SMART
VWC 779 845 5.3e-9 SMART
VWC 867 927 1.68e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115423
AA Change: H562R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111083
Gene: ENSMUSG00000006958
AA Change: H562R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 605 3.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115437
SMART Domains Protein: ENSMUSP00000111097
Gene: ENSMUSG00000022847

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 25 193 5.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151150
Predicted Effect probably benign
Transcript: ENSMUST00000153299
SMART Domains Protein: ENSMUSP00000138259
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
Blast:CHRD 170 236 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231636
Predicted Effect probably damaging
Transcript: ENSMUST00000232646
AA Change: H584R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000231698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232020
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein that dorsalizes early vertebrate embryonic tissues by binding to ventralizing TGF-beta-like bone morphogenetic proteins and sequestering them in latent complexes. The encoded protein may also have roles in organogenesis and during adulthood. It has been suggested that this gene could be a candidate gene for Cornelia de Lange syndrome. Reduced expression of this gene results in enhanced bone regeneration. Alternative splicing results in multiple transcript variants. Other alternative splice variants have been described but their full length sequence has not been determined. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation show some death prior to embryonic day 8.5, but most die perinatally with abnormalities of the skull, malformations of cervical and thoracic vertebrae, cardiovascular defects, and absence of parathyroid and thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afg1l T C 10: 42,330,491 (GRCm39) T59A probably benign Het
Ankrd17 T A 5: 90,412,656 (GRCm39) M1223L possibly damaging Het
Ankrd24 G A 10: 81,474,472 (GRCm39) S68N probably benign Het
Arhgap31 A G 16: 38,445,952 (GRCm39) I131T probably damaging Het
Arhgef10 A T 8: 15,029,836 (GRCm39) I874F probably damaging Het
Arl5b T C 2: 15,074,648 (GRCm39) V43A probably benign Het
BC051665 G A 13: 60,932,854 (GRCm39) H36Y probably benign Het
Cdh9 A G 15: 16,778,392 (GRCm39) D69G probably damaging Het
Chd6 G A 2: 160,808,559 (GRCm39) L1552F probably damaging Het
Dnhd1 G A 7: 105,343,179 (GRCm39) V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 (GRCm39) G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 (GRCm39) probably null Het
Ehbp1l1 A G 19: 5,766,434 (GRCm39) V1303A probably damaging Het
Eif4e1b G A 13: 54,934,704 (GRCm39) E182K probably damaging Het
Fam170b A T 14: 32,557,843 (GRCm39) Q226L possibly damaging Het
Fam193a C T 5: 34,619,475 (GRCm39) P760L probably damaging Het
Gabra5 A T 7: 57,157,796 (GRCm39) L6H probably benign Het
Gabrq G A X: 71,876,989 (GRCm39) R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 118,989,784 (GRCm39) probably null Het
Gm7334 T A 17: 51,006,006 (GRCm39) D97E probably damaging Het
Gpsm1 G A 2: 26,215,395 (GRCm39) A286T probably damaging Het
Gsta4 C A 9: 78,111,611 (GRCm39) Y79* probably null Het
Hcn1 T A 13: 117,793,270 (GRCm39) V174D probably benign Het
Hic1 G T 11: 75,056,620 (GRCm39) C756* probably null Het
Hivep3 C T 4: 119,953,868 (GRCm39) T728I probably benign Het
Ice1 T C 13: 70,752,561 (GRCm39) E1175G possibly damaging Het
Igsf3 T A 3: 101,338,598 (GRCm39) L304Q probably damaging Het
Kpna6 T C 4: 129,551,235 (GRCm39) D90G probably benign Het
Krt73 C T 15: 101,702,363 (GRCm39) G500D probably damaging Het
Lama3 A G 18: 12,535,119 (GRCm39) K156E probably damaging Het
Mdm2 T C 10: 117,531,927 (GRCm39) K94E probably damaging Het
Mitf T C 6: 97,918,060 (GRCm39) S26P probably damaging Het
Myh4 C A 11: 67,147,121 (GRCm39) Q1589K possibly damaging Het
Nlrp4c T A 7: 6,076,113 (GRCm39) V671E probably benign Het
Nop9 C T 14: 55,989,591 (GRCm39) A407V possibly damaging Het
Nrap T A 19: 56,323,474 (GRCm39) H1366L probably damaging Het
Ntrk1 A T 3: 87,685,825 (GRCm39) C766S probably damaging Het
Oog3 C T 4: 143,885,692 (GRCm39) G302D possibly damaging Het
Or4q3 T C 14: 50,583,677 (GRCm39) Y43C probably damaging Het
Or52z15 A G 7: 103,332,068 (GRCm39) N38D possibly damaging Het
Or6c38 T C 10: 128,929,616 (GRCm39) I76V probably benign Het
Or7g27 A G 9: 19,250,154 (GRCm39) T133A probably benign Het
Pdzph1 C T 17: 59,280,747 (GRCm39) V512I probably benign Het
Phf2 A C 13: 48,973,033 (GRCm39) S408A unknown Het
Pigk T G 3: 152,445,793 (GRCm39) L135V probably damaging Het
Ppp2ca C A 11: 52,012,773 (GRCm39) T301N probably benign Het
Ppp4r3a A G 12: 101,024,741 (GRCm39) S253P probably damaging Het
Ptgfrn A T 3: 100,957,438 (GRCm39) I712N probably benign Het
Rapgef2 A T 3: 79,000,010 (GRCm39) D579E probably damaging Het
Rims2 T A 15: 39,325,976 (GRCm39) D769E probably damaging Het
Rptor T A 11: 119,615,887 (GRCm39) C134S probably damaging Het
S100a1 A G 3: 90,418,599 (GRCm39) F72L probably damaging Het
Scube1 T A 15: 83,606,146 (GRCm39) D42V probably damaging Het
Sh3glb1 T C 3: 144,418,446 (GRCm39) D39G probably damaging Het
Sh3pxd2a T C 19: 47,261,689 (GRCm39) T397A probably benign Het
Siglece G A 7: 43,300,956 (GRCm39) T453M probably damaging Het
Slc26a1 G A 5: 108,819,658 (GRCm39) R514W probably damaging Het
Slc4a8 T C 15: 100,685,093 (GRCm39) V156A probably benign Het
Smchd1 A T 17: 71,698,374 (GRCm39) V1134E probably damaging Het
Sorbs2 A G 8: 46,223,613 (GRCm39) Y222C probably damaging Het
Sorcs3 G T 19: 48,592,314 (GRCm39) W326C possibly damaging Het
Taf2 A G 15: 54,934,793 (GRCm39) V45A probably benign Het
Tex16 T C X: 111,150,782 (GRCm39) Y22H probably benign Het
Tiparp A T 3: 65,439,470 (GRCm39) H80L probably damaging Het
Tmem71 T A 15: 66,413,548 (GRCm39) T175S probably benign Het
Tmem87b T A 2: 128,681,090 (GRCm39) V338D probably damaging Het
Trdn A G 10: 33,240,004 (GRCm39) K445R probably damaging Het
Trim14 A G 4: 46,522,039 (GRCm39) F213L probably benign Het
Tubgcp5 T A 7: 55,464,768 (GRCm39) S550T probably benign Het
Tufm A G 7: 126,089,644 (GRCm39) D446G probably benign Het
Vipr1 A T 9: 121,490,485 (GRCm39) Y177F possibly damaging Het
Vmn2r116 A C 17: 23,620,740 (GRCm39) I825L probably damaging Het
Vmn2r12 G T 5: 109,239,910 (GRCm39) Q218K probably damaging Het
Vwa7 G T 17: 35,242,919 (GRCm39) probably null Het
Ywhae T C 11: 75,646,491 (GRCm39) V119A probably damaging Het
Zfand5 A G 19: 21,257,888 (GRCm39) R199G probably damaging Het
Zfp810 T C 9: 22,189,828 (GRCm39) Y360C possibly damaging Het
Zrsr2-ps1 A G 11: 22,923,637 (GRCm39) D137G probably benign Het
Other mutations in Chrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Chrd APN 16 20,559,975 (GRCm39) missense possibly damaging 0.89
IGL01486:Chrd APN 16 20,552,890 (GRCm39) splice site probably null
IGL02120:Chrd APN 16 20,553,291 (GRCm39) missense probably damaging 1.00
IGL02370:Chrd APN 16 20,554,541 (GRCm39) missense possibly damaging 0.52
IGL02675:Chrd APN 16 20,558,699 (GRCm39) splice site probably benign
IGL02678:Chrd APN 16 20,552,770 (GRCm39) missense probably damaging 1.00
IGL02874:Chrd APN 16 20,553,946 (GRCm39) missense probably damaging 1.00
ANU74:Chrd UTSW 16 20,560,069 (GRCm39) missense possibly damaging 0.88
PIT1430001:Chrd UTSW 16 20,557,748 (GRCm39) critical splice donor site probably null
R0016:Chrd UTSW 16 20,553,058 (GRCm39) missense possibly damaging 0.85
R0230:Chrd UTSW 16 20,552,025 (GRCm39) missense probably benign 0.25
R0605:Chrd UTSW 16 20,554,189 (GRCm39) missense probably damaging 1.00
R0831:Chrd UTSW 16 20,560,059 (GRCm39) missense probably damaging 0.99
R1501:Chrd UTSW 16 20,556,283 (GRCm39) missense probably damaging 1.00
R1659:Chrd UTSW 16 20,554,581 (GRCm39) missense probably damaging 0.96
R1823:Chrd UTSW 16 20,560,097 (GRCm39) splice site probably benign
R3001:Chrd UTSW 16 20,556,195 (GRCm39) nonsense probably null
R3002:Chrd UTSW 16 20,556,195 (GRCm39) nonsense probably null
R3874:Chrd UTSW 16 20,557,660 (GRCm39) missense probably damaging 0.99
R4319:Chrd UTSW 16 20,555,798 (GRCm39) missense probably damaging 0.99
R4587:Chrd UTSW 16 20,557,325 (GRCm39) missense possibly damaging 0.58
R4707:Chrd UTSW 16 20,557,558 (GRCm39) missense possibly damaging 0.58
R4857:Chrd UTSW 16 20,557,508 (GRCm39) missense possibly damaging 0.79
R5204:Chrd UTSW 16 20,554,822 (GRCm39) missense probably benign 0.02
R5364:Chrd UTSW 16 20,551,898 (GRCm39) start codon destroyed probably null 0.03
R5445:Chrd UTSW 16 20,557,660 (GRCm39) missense possibly damaging 0.74
R5611:Chrd UTSW 16 20,557,724 (GRCm39) missense probably damaging 1.00
R5940:Chrd UTSW 16 20,553,336 (GRCm39) missense probably null 0.01
R6004:Chrd UTSW 16 20,553,987 (GRCm39) missense possibly damaging 0.92
R6767:Chrd UTSW 16 20,557,376 (GRCm39) missense probably benign 0.00
R6798:Chrd UTSW 16 20,553,056 (GRCm39) missense probably damaging 1.00
R6801:Chrd UTSW 16 20,554,497 (GRCm39) missense possibly damaging 0.68
R6823:Chrd UTSW 16 20,553,486 (GRCm39) missense probably damaging 1.00
R6999:Chrd UTSW 16 20,554,402 (GRCm39) missense probably benign
R7069:Chrd UTSW 16 20,558,183 (GRCm39) missense probably damaging 1.00
R7136:Chrd UTSW 16 20,553,272 (GRCm39) missense possibly damaging 0.82
R7273:Chrd UTSW 16 20,560,316 (GRCm39) missense probably benign 0.32
R7558:Chrd UTSW 16 20,557,304 (GRCm39) missense probably damaging 1.00
R7813:Chrd UTSW 16 20,554,155 (GRCm39) missense probably benign 0.00
R7965:Chrd UTSW 16 20,557,903 (GRCm39) missense probably benign 0.05
R8361:Chrd UTSW 16 20,557,487 (GRCm39) missense possibly damaging 0.92
R8549:Chrd UTSW 16 20,560,027 (GRCm39) missense probably benign 0.40
R8809:Chrd UTSW 16 20,553,270 (GRCm39) missense probably benign 0.19
R8841:Chrd UTSW 16 20,554,487 (GRCm39) splice site probably benign
R9027:Chrd UTSW 16 20,555,737 (GRCm39) missense probably damaging 1.00
R9166:Chrd UTSW 16 20,554,572 (GRCm39) missense probably benign 0.28
R9255:Chrd UTSW 16 20,558,801 (GRCm39) missense probably damaging 1.00
R9618:Chrd UTSW 16 20,552,378 (GRCm39) missense probably damaging 1.00
X0063:Chrd UTSW 16 20,556,314 (GRCm39) critical splice donor site probably null
Z1088:Chrd UTSW 16 20,560,005 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGACTTGCTATTCCCCAAGCCC -3'
(R):5'- TGTAATACCAGGCCACCTGCTCTC -3'

Sequencing Primer
(F):5'- GGATTTAGGATTGCCTGTGC -3'
(R):5'- GTCCACATGGCCCTTCAAG -3'
Posted On 2014-05-23