Incidental Mutation 'R1766:Chrd'
ID194413
Institutional Source Beutler Lab
Gene Symbol Chrd
Ensembl Gene ENSMUSG00000006958
Gene Namechordin
SynonymsChd
MMRRC Submission 039798-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1766 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location20733127-20742384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20737441 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 584 (H584R)
Ref Sequence ENSEMBL: ENSMUSP00000156080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007171] [ENSMUST00000115423] [ENSMUST00000115437] [ENSMUST00000153299] [ENSMUST00000231636] [ENSMUST00000231698] [ENSMUST00000232646]
Predicted Effect probably damaging
Transcript: ENSMUST00000007171
AA Change: H562R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000007171
Gene: ENSMUSG00000006958
AA Change: H562R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 643 2.03e-31 SMART
low complexity region 676 687 N/A INTRINSIC
VWC 701 758 4.69e-10 SMART
VWC 779 845 5.3e-9 SMART
VWC 867 927 1.68e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115423
AA Change: H562R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111083
Gene: ENSMUSG00000006958
AA Change: H562R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 605 3.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115437
SMART Domains Protein: ENSMUSP00000111097
Gene: ENSMUSG00000022847

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 25 193 5.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151150
Predicted Effect probably benign
Transcript: ENSMUST00000153299
SMART Domains Protein: ENSMUSP00000138259
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
Blast:CHRD 170 236 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231689
Predicted Effect probably benign
Transcript: ENSMUST00000231698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232104
Predicted Effect probably damaging
Transcript: ENSMUST00000232646
AA Change: H584R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein that dorsalizes early vertebrate embryonic tissues by binding to ventralizing TGF-beta-like bone morphogenetic proteins and sequestering them in latent complexes. The encoded protein may also have roles in organogenesis and during adulthood. It has been suggested that this gene could be a candidate gene for Cornelia de Lange syndrome. Reduced expression of this gene results in enhanced bone regeneration. Alternative splicing results in multiple transcript variants. Other alternative splice variants have been described but their full length sequence has not been determined. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation show some death prior to embryonic day 8.5, but most die perinatally with abnormalities of the skull, malformations of cervical and thoracic vertebrae, cardiovascular defects, and absence of parathyroid and thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933403O08Rik T C X: 112,241,085 Y22H probably benign Het
Afg1l T C 10: 42,454,495 T59A probably benign Het
Ankrd17 T A 5: 90,264,797 M1223L possibly damaging Het
Ankrd24 G A 10: 81,638,638 S68N probably benign Het
Arhgap31 A G 16: 38,625,590 I131T probably damaging Het
Arhgef10 A T 8: 14,979,836 I874F probably damaging Het
Arl5b T C 2: 15,069,837 V43A probably benign Het
BC051665 G A 13: 60,785,040 H36Y probably benign Het
Cdh9 A G 15: 16,778,306 D69G probably damaging Het
Chd6 G A 2: 160,966,639 L1552F probably damaging Het
Dnhd1 G A 7: 105,693,972 V1508I possibly damaging Het
Dpy19l4 C T 4: 11,303,360 G187D probably damaging Het
Dync2h1 T C 9: 7,015,526 probably null Het
Ehbp1l1 A G 19: 5,716,406 V1303A probably damaging Het
Eif4e1b G A 13: 54,786,891 E182K probably damaging Het
Fam170b A T 14: 32,835,886 Q226L possibly damaging Het
Fam193a C T 5: 34,462,131 P760L probably damaging Het
Gabra5 A T 7: 57,508,048 L6H probably benign Het
Gabrq G A X: 72,833,383 R161H probably damaging Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Gm7334 T A 17: 50,698,978 D97E probably damaging Het
Gpsm1 G A 2: 26,325,383 A286T probably damaging Het
Gsta4 C A 9: 78,204,329 Y79* probably null Het
Hcn1 T A 13: 117,656,734 V174D probably benign Het
Hic1 G T 11: 75,165,794 C756* probably null Het
Hivep3 C T 4: 120,096,671 T728I probably benign Het
Ice1 T C 13: 70,604,442 E1175G possibly damaging Het
Igsf3 T A 3: 101,431,282 L304Q probably damaging Het
Kpna6 T C 4: 129,657,442 D90G probably benign Het
Krt73 C T 15: 101,793,928 G500D probably damaging Het
Lama3 A G 18: 12,402,062 K156E probably damaging Het
Mdm2 T C 10: 117,696,022 K94E probably damaging Het
Mitf T C 6: 97,941,099 S26P probably damaging Het
Myh4 C A 11: 67,256,295 Q1589K possibly damaging Het
Nlrp4c T A 7: 6,073,114 V671E probably benign Het
Nop9 C T 14: 55,752,134 A407V possibly damaging Het
Nrap T A 19: 56,335,042 H1366L probably damaging Het
Ntrk1 A T 3: 87,778,518 C766S probably damaging Het
Olfr625-ps1 A G 7: 103,682,861 N38D possibly damaging Het
Olfr735 T C 14: 50,346,220 Y43C probably damaging Het
Olfr768 T C 10: 129,093,747 I76V probably benign Het
Olfr845 A G 9: 19,338,858 T133A probably benign Het
Oog3 C T 4: 144,159,122 G302D possibly damaging Het
Pdzph1 C T 17: 58,973,752 V512I probably benign Het
Phf2 A C 13: 48,819,557 S408A unknown Het
Pigk T G 3: 152,740,156 L135V probably damaging Het
Ppp2ca C A 11: 52,121,946 T301N probably benign Het
Ppp4r3a A G 12: 101,058,482 S253P probably damaging Het
Ptgfrn A T 3: 101,050,122 I712N probably benign Het
Rapgef2 A T 3: 79,092,703 D579E probably damaging Het
Rims2 T A 15: 39,462,580 D769E probably damaging Het
Rptor T A 11: 119,725,061 C134S probably damaging Het
S100a1 A G 3: 90,511,292 F72L probably damaging Het
Scube1 T A 15: 83,721,945 D42V probably damaging Het
Sh3glb1 T C 3: 144,712,685 D39G probably damaging Het
Sh3pxd2a T C 19: 47,273,250 T397A probably benign Het
Siglece G A 7: 43,651,532 T453M probably damaging Het
Slc26a1 G A 5: 108,671,792 R514W probably damaging Het
Slc4a8 T C 15: 100,787,212 V156A probably benign Het
Smchd1 A T 17: 71,391,379 V1134E probably damaging Het
Sorbs2 A G 8: 45,770,576 Y222C probably damaging Het
Sorcs3 G T 19: 48,603,875 W326C possibly damaging Het
Taf2 A G 15: 55,071,397 V45A probably benign Het
Tiparp A T 3: 65,532,049 H80L probably damaging Het
Tmem71 T A 15: 66,541,699 T175S probably benign Het
Tmem87b T A 2: 128,839,170 V338D probably damaging Het
Trdn A G 10: 33,364,008 K445R probably damaging Het
Trim14 A G 4: 46,522,039 F213L probably benign Het
Tubgcp5 T A 7: 55,815,020 S550T probably benign Het
Tufm A G 7: 126,490,472 D446G probably benign Het
Vipr1 A T 9: 121,661,419 Y177F possibly damaging Het
Vmn2r116 A C 17: 23,401,766 I825L probably damaging Het
Vmn2r12 G T 5: 109,092,044 Q218K probably damaging Het
Vwa7 G T 17: 35,023,943 probably null Het
Ywhae T C 11: 75,755,665 V119A probably damaging Het
Zfand5 A G 19: 21,280,524 R199G probably damaging Het
Zfp810 T C 9: 22,278,532 Y360C possibly damaging Het
Zrsr1 A G 11: 22,973,637 D137G probably benign Het
Other mutations in Chrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Chrd APN 16 20741225 missense possibly damaging 0.89
IGL01486:Chrd APN 16 20734140 splice site probably null
IGL02120:Chrd APN 16 20734541 missense probably damaging 1.00
IGL02370:Chrd APN 16 20735791 missense possibly damaging 0.52
IGL02675:Chrd APN 16 20739949 splice site probably benign
IGL02678:Chrd APN 16 20734020 missense probably damaging 1.00
IGL02874:Chrd APN 16 20735196 missense probably damaging 1.00
ANU74:Chrd UTSW 16 20741319 missense possibly damaging 0.88
PIT1430001:Chrd UTSW 16 20738998 critical splice donor site probably null
R0016:Chrd UTSW 16 20734308 missense possibly damaging 0.85
R0230:Chrd UTSW 16 20733275 missense probably benign 0.25
R0605:Chrd UTSW 16 20735439 missense probably damaging 1.00
R0831:Chrd UTSW 16 20741309 missense probably damaging 0.99
R1501:Chrd UTSW 16 20737533 missense probably damaging 1.00
R1659:Chrd UTSW 16 20735831 missense probably damaging 0.96
R1823:Chrd UTSW 16 20741347 splice site probably benign
R3001:Chrd UTSW 16 20737445 nonsense probably null
R3002:Chrd UTSW 16 20737445 nonsense probably null
R3874:Chrd UTSW 16 20738910 missense probably damaging 0.99
R4319:Chrd UTSW 16 20737048 missense probably damaging 0.99
R4587:Chrd UTSW 16 20738575 missense possibly damaging 0.58
R4707:Chrd UTSW 16 20738808 missense possibly damaging 0.58
R4857:Chrd UTSW 16 20738758 missense possibly damaging 0.79
R5204:Chrd UTSW 16 20736072 missense probably benign 0.02
R5364:Chrd UTSW 16 20733148 start codon destroyed probably null 0.03
R5445:Chrd UTSW 16 20738910 missense possibly damaging 0.74
R5611:Chrd UTSW 16 20738974 missense probably damaging 1.00
R5940:Chrd UTSW 16 20734586 missense probably null 0.01
R6004:Chrd UTSW 16 20735237 missense possibly damaging 0.92
R6767:Chrd UTSW 16 20738626 missense probably benign 0.00
R6798:Chrd UTSW 16 20734306 missense probably damaging 1.00
R6801:Chrd UTSW 16 20735747 missense possibly damaging 0.68
R6823:Chrd UTSW 16 20734736 missense probably damaging 1.00
R6999:Chrd UTSW 16 20735652 missense probably benign
R7069:Chrd UTSW 16 20739433 missense probably damaging 1.00
R7136:Chrd UTSW 16 20734522 missense possibly damaging 0.82
R7273:Chrd UTSW 16 20741566 missense probably benign 0.32
R7558:Chrd UTSW 16 20738554 missense probably damaging 1.00
X0063:Chrd UTSW 16 20737564 critical splice donor site probably null
Z1088:Chrd UTSW 16 20741255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGACTTGCTATTCCCCAAGCCC -3'
(R):5'- TGTAATACCAGGCCACCTGCTCTC -3'

Sequencing Primer
(F):5'- GGATTTAGGATTGCCTGTGC -3'
(R):5'- GTCCACATGGCCCTTCAAG -3'
Posted On2014-05-23