Incidental Mutation 'R0035:Xpo5'
ID19442
Institutional Source Beutler Lab
Gene Symbol Xpo5
Ensembl Gene ENSMUSG00000067150
Gene Nameexportin 5
SynonymsExp5, 2700038C24Rik, 2410004H11Rik
MMRRC Submission 038329-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0035 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location46202855-46242299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46240175 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1001 (T1001A)
Ref Sequence ENSEMBL: ENSMUSP00000084257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087026] [ENSMUST00000087031] [ENSMUST00000124655] [ENSMUST00000142706] [ENSMUST00000173232] [ENSMUST00000173349]
Predicted Effect probably benign
Transcript: ENSMUST00000087026
SMART Domains Protein: ENSMUSP00000084252
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 339 4.53e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087031
AA Change: T1001A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000084257
Gene: ENSMUSG00000067150
AA Change: T1001A

DomainStartEndE-ValueType
IBN_N 33 100 6.73e-3 SMART
Pfam:Xpo1 109 271 1.4e-34 PFAM
low complexity region 326 342 N/A INTRINSIC
low complexity region 770 779 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124655
SMART Domains Protein: ENSMUSP00000122026
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 1 253 2.14e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142706
SMART Domains Protein: ENSMUSP00000116998
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 60 255 9.13e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152583
Predicted Effect probably benign
Transcript: ENSMUST00000173232
SMART Domains Protein: ENSMUSP00000133597
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
Pfam:RNA_pol_L 61 100 1.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173349
SMART Domains Protein: ENSMUSP00000133861
Gene: ENSMUSG00000067148

DomainStartEndE-ValueType
RPOLD 42 170 2.3e-5 SMART
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.8%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the karyopherin family that is required for the transport of small RNAs and double-stranded RNA-binding proteins from the nucleus to the cytoplasm. The encoded protein translocates cargo through the nuclear pore complex in a RanGTP-dependent process. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110040N11Rik T C 7: 81,788,549 T20A probably benign Het
4932438A13Rik T A 3: 36,987,598 Y2708* probably null Het
9130011E15Rik A T 19: 45,891,240 M558K probably damaging Het
Aadacl4 A G 4: 144,617,941 T96A probably damaging Het
Abcb6 A G 1: 75,175,007 V473A possibly damaging Het
Abo C A 2: 26,843,373 K273N possibly damaging Het
Acvr1c A G 2: 58,315,779 probably benign Het
Adcy8 A T 15: 64,699,368 V1142D probably benign Het
Akna T A 4: 63,382,445 H591L probably benign Het
Aox2 T C 1: 58,354,422 V1247A probably benign Het
Ap4b1 T C 3: 103,820,664 probably benign Het
Atm A G 9: 53,513,180 V607A probably benign Het
Cass4 C T 2: 172,416,492 P137S probably damaging Het
Cfap53 A G 18: 74,300,207 E121G probably damaging Het
Chmp6 T C 11: 119,916,682 V31A probably damaging Het
Clec4a3 T A 6: 122,967,549 Y185N probably damaging Het
Clic5 A G 17: 44,275,313 T230A probably damaging Het
Clspn G T 4: 126,565,003 probably null Het
Cntn1 T A 15: 92,232,088 probably benign Het
Col4a3 G A 1: 82,672,753 G577R unknown Het
Defa21 T A 8: 21,025,768 probably null Het
Deup1 T C 9: 15,599,821 R221G possibly damaging Het
Dnah8 A T 17: 30,683,621 probably benign Het
Dnase1l2 A G 17: 24,441,075 V273A probably damaging Het
Gm5134 T A 10: 75,993,864 F328Y probably benign Het
Golph3 A T 15: 12,339,690 E96D probably damaging Het
Hspd1 A G 1: 55,083,783 V151A probably benign Het
Htr1f A C 16: 64,926,497 I144S probably damaging Het
Il1f8 A T 2: 24,159,878 H167L probably benign Het
Il23r A G 6: 67,473,788 probably benign Het
Il25 A G 14: 54,933,096 E42G probably damaging Het
Klrb1-ps1 C T 6: 129,129,343 A149V possibly damaging Het
Kmt2e T A 5: 23,485,621 probably benign Het
Ktn1 A G 14: 47,730,379 N1167D probably benign Het
Lama4 T A 10: 39,072,738 D832E probably benign Het
Map1b A G 13: 99,435,338 S292P probably damaging Het
Map6 C T 7: 99,317,608 T345I probably damaging Het
Mark2 A T 19: 7,284,652 probably benign Het
Me3 C A 7: 89,851,759 H559Q probably benign Het
Myo1b A G 1: 51,778,382 F574L probably damaging Het
Nos2 T C 11: 78,945,727 S431P probably damaging Het
Nr1h5 T A 3: 102,949,573 K208* probably null Het
Nup214 T C 2: 31,990,367 probably null Het
Obp2b T C 2: 25,738,633 L133P probably damaging Het
Olfr173 A T 16: 58,797,122 C241* probably null Het
Olfr305 T C 7: 86,364,187 D50G possibly damaging Het
Osbp2 C T 11: 3,717,997 probably benign Het
Ptafr C A 4: 132,579,553 L85I probably benign Het
Ptprk T A 10: 28,263,508 Y76* probably null Het
Rad50 A G 11: 53,655,027 probably benign Het
Rasef G T 4: 73,762,854 probably benign Het
Slitrk6 A T 14: 110,749,932 L781H probably damaging Het
Tbc1d1 T A 5: 64,256,737 I18N probably damaging Het
Tbc1d17 T C 7: 44,841,408 N587D probably benign Het
Trank1 A T 9: 111,366,776 K1289N probably benign Het
Tspyl3 A G 2: 153,224,320 S333P probably damaging Het
Ush2a G A 1: 188,356,888 V347I probably benign Het
Usp17le G T 7: 104,769,062 S291* probably null Het
Usp24 T A 4: 106,368,027 S619T probably benign Het
Vmn2r10 T C 5: 108,997,601 probably benign Het
Vmn2r78 A G 7: 86,920,205 E102G probably benign Het
Vwa3b G A 1: 37,165,689 V85I possibly damaging Het
Wwp1 A C 4: 19,631,116 I639R probably damaging Het
Zc3h12c A T 9: 52,143,747 M235K probably benign Het
Zfp619 G A 7: 39,537,282 G912D probably damaging Het
Other mutations in Xpo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Xpo5 APN 17 46225047 missense probably damaging 1.00
IGL00650:Xpo5 APN 17 46208246 missense probably damaging 1.00
IGL00785:Xpo5 APN 17 46204692 missense probably damaging 1.00
IGL01869:Xpo5 APN 17 46242207 missense possibly damaging 0.75
IGL01929:Xpo5 APN 17 46202929 missense probably benign 0.13
IGL02433:Xpo5 APN 17 46239520 missense probably damaging 0.99
IGL02550:Xpo5 APN 17 46229329 missense probably benign 0.16
IGL02637:Xpo5 APN 17 46235979 missense probably damaging 1.00
IGL02942:Xpo5 APN 17 46208133 missense probably damaging 0.99
IGL03004:Xpo5 APN 17 46207840 missense probably damaging 1.00
IGL03149:Xpo5 APN 17 46215814 splice site probably null
IGL03296:Xpo5 APN 17 46221394 nonsense probably null
fortify UTSW 17 46221421 missense probably benign 0.01
fortissimo UTSW 17 46235970 missense probably benign 0.36
PIT4403001:Xpo5 UTSW 17 46239569 missense probably benign 0.01
R0009:Xpo5 UTSW 17 46204786 splice site probably benign
R0009:Xpo5 UTSW 17 46204786 splice site probably benign
R0276:Xpo5 UTSW 17 46241507 missense probably damaging 1.00
R0626:Xpo5 UTSW 17 46221433 missense probably damaging 1.00
R0843:Xpo5 UTSW 17 46222650 splice site probably benign
R1440:Xpo5 UTSW 17 46207927 splice site probably benign
R1506:Xpo5 UTSW 17 46227888 missense probably benign 0.04
R1513:Xpo5 UTSW 17 46226980 missense probably benign 0.06
R2060:Xpo5 UTSW 17 46225091 missense probably damaging 1.00
R2258:Xpo5 UTSW 17 46240896 nonsense probably null
R2259:Xpo5 UTSW 17 46240896 nonsense probably null
R2260:Xpo5 UTSW 17 46240896 nonsense probably null
R2263:Xpo5 UTSW 17 46230343 missense probably benign
R3016:Xpo5 UTSW 17 46220831 missense probably damaging 1.00
R3149:Xpo5 UTSW 17 46242247 splice site probably null
R3150:Xpo5 UTSW 17 46242247 splice site probably null
R4613:Xpo5 UTSW 17 46236963 missense probably benign
R4784:Xpo5 UTSW 17 46222717 missense possibly damaging 0.59
R4808:Xpo5 UTSW 17 46235970 missense probably benign 0.36
R4981:Xpo5 UTSW 17 46220817 missense probably damaging 0.99
R5159:Xpo5 UTSW 17 46217609 missense probably damaging 1.00
R5286:Xpo5 UTSW 17 46234480 missense probably benign
R5294:Xpo5 UTSW 17 46236922 missense probably benign 0.12
R5550:Xpo5 UTSW 17 46234492 missense possibly damaging 0.87
R5750:Xpo5 UTSW 17 46218630 critical splice donor site probably null
R5774:Xpo5 UTSW 17 46241846 nonsense probably null
R5921:Xpo5 UTSW 17 46221421 missense probably benign 0.01
R6165:Xpo5 UTSW 17 46235957 missense possibly damaging 0.53
R6576:Xpo5 UTSW 17 46240808 splice site probably null
R7244:Xpo5 UTSW 17 46214625 missense probably damaging 1.00
R7414:Xpo5 UTSW 17 46221369 missense probably benign
R7737:Xpo5 UTSW 17 46236090 splice site probably null
R8144:Xpo5 UTSW 17 46208219 missense probably benign 0.09
R8752:Xpo5 UTSW 17 46236912 critical splice acceptor site probably benign
R8882:Xpo5 UTSW 17 46227740 missense possibly damaging 0.82
X0019:Xpo5 UTSW 17 46234544 missense probably benign 0.00
X0062:Xpo5 UTSW 17 46230266 missense probably damaging 1.00
Z1176:Xpo5 UTSW 17 46220762 missense probably benign 0.11
Z1177:Xpo5 UTSW 17 46225124 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- CGGCAATGCTTTTAGTTCAGCCCC -3'
(R):5'- CAGAGGCCAAATACAAGGACTCTGC -3'

Sequencing Primer
(F):5'- GTCATAAGGCAGCTCTGCTAC -3'
(R):5'- GCAGCTATGTTTGTGCATTTAC -3'
Posted On2013-04-11