Incidental Mutation 'R1767:Coq10b'
ID 194433
Institutional Source Beutler Lab
Gene Symbol Coq10b
Ensembl Gene ENSMUSG00000025981
Gene Name coenzyme Q10B
Synonyms 1700030I21Rik, 9530077A17Rik, 1500041J02Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.398) question?
Stock # R1767 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 55091929-55111861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 55100513 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 66 (R66G)
Ref Sequence ENSEMBL: ENSMUSP00000027125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027125] [ENSMUST00000087617]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027125
AA Change: R66G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027125
Gene: ENSMUSG00000025981
AA Change: R66G

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 88 217 2.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087617
SMART Domains Protein: ENSMUSP00000084899
Gene: ENSMUSG00000025981

DomainStartEndE-ValueType
Pfam:Polyketide_cyc 38 167 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190239
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik T C 4: 124,743,754 (GRCm39) N128S possibly damaging Het
Adam26b T A 8: 43,972,948 (GRCm39) I685F probably benign Het
Adgrf5 A T 17: 43,761,455 (GRCm39) Y1050F possibly damaging Het
Alcam A T 16: 52,091,077 (GRCm39) N480K probably damaging Het
Alk T A 17: 72,207,693 (GRCm39) H1014L possibly damaging Het
Arhgef2 A G 3: 88,551,260 (GRCm39) Q778R probably damaging Het
Arhgef6 T C X: 56,383,922 (GRCm39) M5V probably benign Het
Ascc3 T A 10: 50,594,472 (GRCm39) I1189N probably damaging Het
AU040320 G A 4: 126,734,517 (GRCm39) G713D probably damaging Het
Bmpr1a A G 14: 34,169,727 (GRCm39) probably null Het
Bpifa6 A G 2: 153,829,147 (GRCm39) T225A possibly damaging Het
Cacna1g T C 11: 94,350,628 (GRCm39) S406G probably benign Het
Ccdc198 G A 14: 49,473,341 (GRCm39) T128I probably benign Het
Ccdc40 T A 11: 119,121,522 (GRCm39) probably null Het
Cckbr A T 7: 105,083,758 (GRCm39) I229F possibly damaging Het
Cers3 A G 7: 66,433,151 (GRCm39) K156R probably damaging Het
Chd1 T A 17: 15,990,565 (GRCm39) W1706R probably damaging Het
Col11a2 T A 17: 34,282,869 (GRCm39) probably benign Het
Cpn2 A T 16: 30,078,485 (GRCm39) Y405* probably null Het
Dis3 A T 14: 99,321,578 (GRCm39) Y590N probably damaging Het
Dpy19l1 T C 9: 24,373,880 (GRCm39) H270R probably benign Het
Dync1h1 G A 12: 110,602,943 (GRCm39) E2195K probably benign Het
Ephx1 C T 1: 180,822,242 (GRCm39) G101S probably damaging Het
Flg A T 3: 93,187,220 (GRCm39) Y224F possibly damaging Het
Focad G T 4: 88,275,705 (GRCm39) V1105L unknown Het
Fzd1 A G 5: 4,806,812 (GRCm39) Y257H probably benign Het
Gm11116 T C 5: 88,259,311 (GRCm39) probably benign Het
Gm11938 G A 11: 99,494,071 (GRCm39) S8F unknown Het
Grin3a A T 4: 49,844,423 (GRCm39) V220E probably damaging Het
Gstt2 T C 10: 75,670,098 (GRCm39) D8G probably damaging Het
Gtf3c3 C T 1: 54,456,937 (GRCm39) A488T probably damaging Het
Hook3 A G 8: 26,561,084 (GRCm39) probably null Het
Itpr2 T C 6: 146,251,566 (GRCm39) D993G possibly damaging Het
Jhy T C 9: 40,872,444 (GRCm39) R22G probably benign Het
Krt13 A C 11: 100,011,926 (GRCm39) H132Q possibly damaging Het
Krtap27-1 G A 16: 88,468,199 (GRCm39) S115L probably damaging Het
L1td1 T C 4: 98,625,686 (GRCm39) V627A probably benign Het
Lrrn4cl A G 19: 8,829,135 (GRCm39) T38A probably benign Het
Ly96 A G 1: 16,776,399 (GRCm39) T112A probably benign Het
Meltf G T 16: 31,702,747 (GRCm39) C158F probably damaging Het
Mycbp2 A T 14: 103,485,841 (GRCm39) H1040Q probably damaging Het
Npas4 G A 19: 5,038,211 (GRCm39) P199L probably benign Het
Or12j3 T C 7: 139,953,389 (GRCm39) I45V possibly damaging Het
Or52r1 T A 7: 102,536,833 (GRCm39) I176F probably damaging Het
Or8k3b A G 2: 86,520,728 (GRCm39) M197T probably benign Het
Pcdh10 A T 3: 45,338,612 (GRCm39) H923L probably damaging Het
Pias3 T C 3: 96,608,719 (GRCm39) S228P probably damaging Het
Pign A G 1: 105,580,917 (GRCm39) V154A probably benign Het
Plod3 T A 5: 137,019,030 (GRCm39) V305E possibly damaging Het
Prkra G T 2: 76,477,584 (GRCm39) H40Q possibly damaging Het
Prss22 T A 17: 24,215,331 (GRCm39) E148D probably benign Het
Psg17 A G 7: 18,550,727 (GRCm39) V376A possibly damaging Het
Retnlg A T 16: 48,693,991 (GRCm39) D49V possibly damaging Het
Rnf26rt A T 6: 76,474,588 (GRCm39) N9K unknown Het
Rtp1 A G 16: 23,250,124 (GRCm39) E163G probably damaging Het
Slc6a20a T A 9: 123,466,165 (GRCm39) I522F probably damaging Het
Slco5a1 T C 1: 13,059,839 (GRCm39) D294G probably damaging Het
Slco6d1 A G 1: 98,418,274 (GRCm39) T487A possibly damaging Het
Smarcc2 A T 10: 128,304,951 (GRCm39) D262V possibly damaging Het
Sned1 G A 1: 93,209,376 (GRCm39) V830M possibly damaging Het
Ssbp3 G T 4: 106,904,612 (GRCm39) D336Y probably damaging Het
Sun2 A G 15: 79,609,758 (GRCm39) S694P probably benign Het
Tdp1 G A 12: 99,857,602 (GRCm39) probably null Het
Tfap2a A T 13: 40,878,613 (GRCm39) I204N probably damaging Het
Tfip11 T A 5: 112,482,298 (GRCm39) W519R probably damaging Het
Tie1 T C 4: 118,333,373 (GRCm39) E831G possibly damaging Het
Tjp1 A G 7: 64,962,301 (GRCm39) probably null Het
Tln2 C T 9: 67,193,796 (GRCm39) A1773T probably benign Het
Tmem39b A C 4: 129,586,976 (GRCm39) I78M possibly damaging Het
Trank1 T C 9: 111,220,547 (GRCm39) V2428A probably benign Het
Trim35 A G 14: 66,541,617 (GRCm39) E247G probably damaging Het
Tsc22d1 T C 14: 76,655,542 (GRCm39) S674P probably damaging Het
Tsn A T 1: 118,228,618 (GRCm39) D201E probably damaging Het
Usp42 A T 5: 143,700,621 (GRCm39) V1134E possibly damaging Het
Uvrag A G 7: 98,748,601 (GRCm39) I117T probably damaging Het
Vmn1r192 A G 13: 22,371,441 (GRCm39) S260P probably benign Het
Vmn2r110 C T 17: 20,800,840 (GRCm39) A531T possibly damaging Het
Wdsub1 A T 2: 59,689,058 (GRCm39) I388N probably damaging Het
Wnt10b A T 15: 98,670,556 (GRCm39) L228Q probably damaging Het
Zbtb34 A C 2: 33,301,348 (GRCm39) S398A possibly damaging Het
Other mutations in Coq10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00645:Coq10b APN 1 55,100,468 (GRCm39) missense probably benign
IGL00697:Coq10b APN 1 55,100,424 (GRCm39) splice site probably null
R1517:Coq10b UTSW 1 55,103,416 (GRCm39) missense probably damaging 1.00
R1751:Coq10b UTSW 1 55,100,513 (GRCm39) missense probably damaging 0.99
R2195:Coq10b UTSW 1 55,100,457 (GRCm39) missense probably damaging 1.00
R2421:Coq10b UTSW 1 55,092,136 (GRCm39) missense probably benign 0.00
R4796:Coq10b UTSW 1 55,110,957 (GRCm39) missense probably damaging 1.00
R4851:Coq10b UTSW 1 55,110,903 (GRCm39) missense probably benign 0.13
R5367:Coq10b UTSW 1 55,092,143 (GRCm39) missense probably benign
R5534:Coq10b UTSW 1 55,103,359 (GRCm39) missense possibly damaging 0.83
R5979:Coq10b UTSW 1 55,092,077 (GRCm39) missense probably benign 0.00
R7402:Coq10b UTSW 1 55,100,500 (GRCm39) missense probably benign 0.00
R7836:Coq10b UTSW 1 55,092,013 (GRCm39) start gained probably benign
R7931:Coq10b UTSW 1 55,092,152 (GRCm39) splice site probably benign
R9292:Coq10b UTSW 1 55,110,868 (GRCm39) missense probably damaging 1.00
R9426:Coq10b UTSW 1 55,106,719 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- AGCAGGAGTCAGGAAATTCCCCAG -3'
(R):5'- CAGCAAGGGCTATAGACAGGCTTAC -3'

Sequencing Primer
(F):5'- CTAGATGGTAACTATACTGCCAGC -3'
(R):5'- CTATAGACAGGCTTACATAGCAGTG -3'
Posted On 2014-05-23