Incidental Mutation 'R1767:AU040320'
ID194457
Institutional Source Beutler Lab
Gene Symbol AU040320
Ensembl Gene ENSMUSG00000028830
Gene Nameexpressed sequence AU040320
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1767 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126753544-126870070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 126840724 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 713 (G713D)
Ref Sequence ENSEMBL: ENSMUSP00000099668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047431] [ENSMUST00000102607] [ENSMUST00000102608]
Predicted Effect probably damaging
Transcript: ENSMUST00000047431
AA Change: G713D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037802
Gene: ENSMUSG00000028830
AA Change: G713D

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102607
AA Change: G713D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099667
Gene: ENSMUSG00000028830
AA Change: G713D

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102608
AA Change: G713D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099668
Gene: ENSMUSG00000028830
AA Change: G713D

DomainStartEndE-ValueType
low complexity region 83 97 N/A INTRINSIC
FN3 113 391 8.45e1 SMART
IG_like 305 398 3.57e1 SMART
PKD 309 400 3.1e-1 SMART
FN3 399 485 2.7e1 SMART
PKD 408 497 1.87e-4 SMART
FN3 502 676 4.47e1 SMART
PKD 503 593 3.22e-8 SMART
IG_like 508 591 1.17e1 SMART
IG_like 597 782 1.66e2 SMART
PKD 599 687 8.98e-7 SMART
PKD 693 784 1.05e-7 SMART
FN3 694 772 3.71e1 SMART
transmembrane domain 927 949 N/A INTRINSIC
low complexity region 995 1010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155341
Meta Mutation Damage Score 0.8562 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate gene for dyslexia susceptibility.[provided by RefSeq, Apr 2009]
PHENOTYPE: Null mice display decreased susceptibility to adenoviral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik T C 4: 124,849,961 N128S possibly damaging Het
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Adgrf5 A T 17: 43,450,564 Y1050F possibly damaging Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Alk T A 17: 71,900,698 H1014L possibly damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
Bmpr1a A G 14: 34,447,770 probably null Het
Bpifa6 A G 2: 153,987,227 T225A possibly damaging Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cckbr A T 7: 105,434,551 I229F possibly damaging Het
Cers3 A G 7: 66,783,403 K156R probably damaging Het
Chd1 T A 17: 15,770,303 W1706R probably damaging Het
Col11a2 T A 17: 34,063,895 probably benign Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Dis3 A T 14: 99,084,142 Y590N probably damaging Het
Dpy19l1 T C 9: 24,462,584 H270R probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Focad G T 4: 88,357,468 V1105L unknown Het
Fzd1 A G 5: 4,756,812 Y257H probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm11938 G A 11: 99,603,245 S8F unknown Het
Gm9008 A T 6: 76,497,605 N9K unknown Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hook3 A G 8: 26,071,056 probably null Het
Itpr2 T C 6: 146,350,068 D993G possibly damaging Het
Jhy T C 9: 40,961,148 R22G probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
Krtap27-1 G A 16: 88,671,311 S115L probably damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr1087 A G 2: 86,690,384 M197T probably benign Het
Olfr530 T C 7: 140,373,476 I45V possibly damaging Het
Olfr569 T A 7: 102,887,626 I176F probably damaging Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Prss22 T A 17: 23,996,357 E148D probably benign Het
Psg17 A G 7: 18,816,802 V376A possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Slco5a1 T C 1: 12,989,615 D294G probably damaging Het
Slco6d1 A G 1: 98,490,549 T487A possibly damaging Het
Smarcc2 A T 10: 128,469,082 D262V possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tjp1 A G 7: 65,312,553 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Usp42 A T 5: 143,714,866 V1134E possibly damaging Het
Uvrag A G 7: 99,099,394 I117T probably damaging Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r110 C T 17: 20,580,578 A531T possibly damaging Het
Wdsub1 A T 2: 59,858,714 I388N probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zbtb34 A C 2: 33,411,336 S398A possibly damaging Het
Other mutations in AU040320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:AU040320 APN 4 126792234 missense probably benign
IGL00835:AU040320 APN 4 126757071 splice site probably null
IGL00964:AU040320 APN 4 126854406 nonsense probably null
IGL00978:AU040320 APN 4 126828839 missense probably benign 0.00
IGL01396:AU040320 APN 4 126869378 intron probably benign
IGL02129:AU040320 APN 4 126823692 missense probably damaging 1.00
IGL02148:AU040320 APN 4 126839676 missense possibly damaging 0.64
IGL02179:AU040320 APN 4 126835612 missense probably benign 0.43
IGL02696:AU040320 APN 4 126842587 missense probably damaging 1.00
PIT4677001:AU040320 UTSW 4 126792237 missense probably benign 0.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0063:AU040320 UTSW 4 126839672 missense probably damaging 1.00
R0356:AU040320 UTSW 4 126837362 missense probably damaging 1.00
R0865:AU040320 UTSW 4 126848884 missense possibly damaging 0.94
R1165:AU040320 UTSW 4 126823640 splice site probably benign
R1216:AU040320 UTSW 4 126816483 splice site probably benign
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1464:AU040320 UTSW 4 126792031 missense possibly damaging 0.92
R1751:AU040320 UTSW 4 126840724 missense probably damaging 1.00
R1900:AU040320 UTSW 4 126853280 splice site probably null
R2173:AU040320 UTSW 4 126792276 missense probably benign 0.02
R2414:AU040320 UTSW 4 126868691 critical splice acceptor site probably null
R4061:AU040320 UTSW 4 126835695 missense probably damaging 1.00
R4354:AU040320 UTSW 4 126854399 unclassified probably benign
R4751:AU040320 UTSW 4 126854466 splice site probably null
R4790:AU040320 UTSW 4 126847215 missense possibly damaging 0.62
R4799:AU040320 UTSW 4 126839669 missense probably benign 0.01
R4825:AU040320 UTSW 4 126791793 missense probably damaging 1.00
R4908:AU040320 UTSW 4 126853288 missense probably damaging 1.00
R4914:AU040320 UTSW 4 126835676 nonsense probably null
R5085:AU040320 UTSW 4 126828871 missense possibly damaging 0.83
R5320:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5410:AU040320 UTSW 4 126823716 missense possibly damaging 0.52
R5543:AU040320 UTSW 4 126841224 missense probably damaging 1.00
R5684:AU040320 UTSW 4 126792146 missense probably benign 0.06
R5729:AU040320 UTSW 4 126830415 missense probably damaging 1.00
R5918:AU040320 UTSW 4 126814271 missense probably benign 0.32
R6123:AU040320 UTSW 4 126869386 intron probably benign
R6456:AU040320 UTSW 4 126842491 missense probably benign 0.03
R6523:AU040320 UTSW 4 126868760 critical splice donor site probably null
R6591:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6603:AU040320 UTSW 4 126792253 missense probably benign 0.02
R6664:AU040320 UTSW 4 126835650 missense probably damaging 1.00
R6691:AU040320 UTSW 4 126836670 missense possibly damaging 0.81
R6864:AU040320 UTSW 4 126847819 missense probably damaging 0.98
R6891:AU040320 UTSW 4 126846438 missense possibly damaging 0.93
R6895:AU040320 UTSW 4 126791930 missense probably damaging 1.00
R7064:AU040320 UTSW 4 126792072 missense probably benign 0.01
R7351:AU040320 UTSW 4 126816444 missense probably damaging 0.98
R7453:AU040320 UTSW 4 126835700 critical splice donor site probably null
R7467:AU040320 UTSW 4 126814310 missense probably benign 0.06
R7492:AU040320 UTSW 4 126847855 missense possibly damaging 0.56
R7513:AU040320 UTSW 4 126792264 missense probably benign 0.01
R7702:AU040320 UTSW 4 126814373 missense probably benign 0.23
R7733:AU040320 UTSW 4 126835529 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCTCTGCACTCTTGGATAAGCAC -3'
(R):5'- CAGTTGTAGAATGACCCACGGGAAG -3'

Sequencing Primer
(F):5'- AACAGCTCCCTATTCGAGGTG -3'
(R):5'- TGACTCCAGAGCACAATCTCAG -3'
Posted On2014-05-23