Incidental Mutation 'R0077:Cfap65'
ID 19447
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 038364-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.677) question?
Stock # R0077 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 74971077 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Cysteine at position 80 (W80C)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably damaging
Transcript: ENSMUST00000094844
AA Change: W80C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: W80C

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139950
Meta Mutation Damage Score 0.8107 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.4%
  • 20x: 90.5%
Validation Efficiency 83% (159/192)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T C 5: 81,919,532 (GRCm39) probably benign Het
Adgrl4 A G 3: 151,223,418 (GRCm39) I624V probably damaging Het
AI661453 A G 17: 47,780,287 (GRCm39) probably benign Het
Alg12 C T 15: 88,700,181 (GRCm39) E60K probably damaging Het
Angel2 A T 1: 190,665,284 (GRCm39) N72Y possibly damaging Het
Ank1 C A 8: 23,630,183 (GRCm39) P81Q probably damaging Het
Atp6v1c2 A T 12: 17,371,613 (GRCm39) D61E probably damaging Het
Bpi T A 2: 158,103,254 (GRCm39) M83K probably damaging Het
Capn7 A G 14: 31,090,072 (GRCm39) I642V probably benign Het
Ccdc134 T C 15: 82,015,938 (GRCm39) probably benign Het
Ccr3 C T 9: 123,829,061 (GRCm39) T132I probably damaging Het
Chaf1a T A 17: 56,354,384 (GRCm39) I218K unknown Het
Ddx23 A G 15: 98,554,481 (GRCm39) probably null Het
Dmkn A G 7: 30,464,719 (GRCm39) S231G probably benign Het
Ep300 T C 15: 81,525,514 (GRCm39) I1446T unknown Het
Fmnl1 T C 11: 103,080,795 (GRCm39) F318S probably damaging Het
Grik5 A T 7: 24,722,805 (GRCm39) V497E probably damaging Het
Gtf2ird2 T C 5: 134,242,925 (GRCm39) Y380H probably damaging Het
Hecw2 C T 1: 53,907,990 (GRCm39) probably benign Het
Hspb7 A G 4: 141,151,358 (GRCm39) I167V probably damaging Het
Kcnh2 T A 5: 24,527,700 (GRCm39) N884I probably benign Het
Krba1 T C 6: 48,382,159 (GRCm39) probably benign Het
Krt18 G T 15: 101,939,409 (GRCm39) R294L probably benign Het
Lctl T A 9: 64,029,389 (GRCm39) M1K probably null Het
Lingo2 G A 4: 35,708,375 (GRCm39) S535F possibly damaging Het
Lrba A C 3: 86,449,995 (GRCm39) N2105H probably damaging Het
Lrrc10 A G 10: 116,881,419 (GRCm39) D31G probably damaging Het
Lrrtm1 T A 6: 77,220,855 (GRCm39) V104E probably damaging Het
Mgat3 C T 15: 80,096,778 (GRCm39) T535I probably benign Het
Nav3 T C 10: 109,552,503 (GRCm39) I1780V possibly damaging Het
Nlrc4 A G 17: 74,753,826 (GRCm39) W186R probably damaging Het
Nr2c1 T A 10: 94,024,117 (GRCm39) F441I probably benign Het
Obscn A G 11: 58,942,347 (GRCm39) probably benign Het
Or1p1 T C 11: 74,179,501 (GRCm39) F10L probably benign Het
Or2a56 T C 6: 42,932,707 (GRCm39) S92P probably benign Het
Or56b34 T C 7: 104,937,726 (GRCm39) V142A probably damaging Het
Or5au1 T C 14: 52,273,442 (GRCm39) N42S possibly damaging Het
Osr1 A T 12: 9,629,691 (GRCm39) Y188F probably damaging Het
Pak2 A T 16: 31,852,661 (GRCm39) N293K possibly damaging Het
Pappa A T 4: 65,226,049 (GRCm39) T1301S probably damaging Het
Pde4dip G A 3: 97,660,442 (GRCm39) Q679* probably null Het
Pik3r5 T A 11: 68,377,448 (GRCm39) probably null Het
Plbd2 C T 5: 120,624,104 (GRCm39) probably null Het
Ppp1r3a G T 6: 14,754,516 (GRCm39) P244T possibly damaging Het
Pum1 C A 4: 130,499,985 (GRCm39) R960S probably benign Het
Ralgapb T C 2: 158,315,169 (GRCm39) Y845H probably damaging Het
Rbms1 A T 2: 60,589,179 (GRCm39) M287K possibly damaging Het
Rdh1 A T 10: 127,595,906 (GRCm39) I34F probably damaging Het
Rgl3 T A 9: 21,885,398 (GRCm39) Q644L probably benign Het
Rpap2 T C 5: 107,768,340 (GRCm39) S393P probably damaging Het
Rsad2 T C 12: 26,506,376 (GRCm39) S15G probably damaging Het
Rspo1 G A 4: 124,885,190 (GRCm39) R22Q probably benign Het
S100a11 A C 3: 93,431,509 (GRCm39) probably null Het
Septin4 T C 11: 87,472,022 (GRCm39) S11P probably benign Het
Serpina1c T C 12: 103,862,350 (GRCm39) S322G probably benign Het
Setdb1 A T 3: 95,248,762 (GRCm39) C385S probably damaging Het
Shank2 A T 7: 143,746,204 (GRCm39) I193F possibly damaging Het
Slc4a11 G T 2: 130,528,221 (GRCm39) probably benign Het
Snrnp40 C G 4: 130,271,836 (GRCm39) probably null Het
Tbcd C A 11: 121,485,100 (GRCm39) Q761K probably benign Het
Tmed6 C T 8: 107,792,198 (GRCm39) V16M probably damaging Het
Tmem229a T C 6: 24,955,701 (GRCm39) T18A probably benign Het
Tsc1 T A 2: 28,568,955 (GRCm39) probably benign Het
Ube2m T C 7: 12,769,657 (GRCm39) N49D probably damaging Het
Ubqlnl T C 7: 103,799,254 (GRCm39) D81G probably damaging Het
Vmn2r56 A G 7: 12,449,332 (GRCm39) V302A probably benign Het
Vmn2r73 T A 7: 85,525,075 (GRCm39) R24S probably benign Het
Wfs1 C A 5: 37,130,538 (GRCm39) S236I probably damaging Het
Xpot A T 10: 121,441,544 (GRCm39) N560K probably benign Het
Yipf3 A G 17: 46,562,503 (GRCm39) T303A probably benign Het
Zfp790 T C 7: 29,524,300 (GRCm39) W19R probably damaging Het
Zfp846 T C 9: 20,505,303 (GRCm39) C388R probably benign Het
Zpr1 T A 9: 46,184,634 (GRCm39) I47N probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74,966,791 (GRCm39) missense probably benign 0.06
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGCAAGTAAGAAGGCCCCAC -3'
(R):5'- GGGACTTTCATCACCCCATAAGTGC -3'

Sequencing Primer
(F):5'- GGATTCTTCACACTGTACATGTTTTG -3'
(R):5'- TTTCATCACCCCATAAGTGCTAAAAG -3'
Posted On 2013-04-11