Mutagenetix > Incidental Mutations

Incidental Mutation 'R0077:Cfap65'

19447

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

MMRRC Submission

038364-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R0077 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 74931918 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Cysteine at position 80 (W80C)

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094844
AA Change: W80C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: W80C

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139950

Meta Mutation Damage Score

0.8107

Coding Region Coverage

1x: 98.9%
3x: 97.9%
10x: 95.4%
20x: 90.5%

Validation Efficiency

83% (159/192)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrl3	T	C	5: 81,771,685		probably benign	Het
Adgrl4	A	G	3: 151,517,781	I624V	probably damaging	Het
AI661453	A	G	17: 47,469,362		probably benign	Het
Alg12	C	T	15: 88,815,978	E60K	probably damaging	Het
Angel2	A	T	1: 190,933,087	N72Y	possibly damaging	Het
Ank1	C	A	8: 23,140,167	P81Q	probably damaging	Het
Atp6v1c2	A	T	12: 17,321,612	D61E	probably damaging	Het
Bpi	T	A	2: 158,261,334	M83K	probably damaging	Het
Capn7	A	G	14: 31,368,115	I642V	probably benign	Het
Ccdc134	T	C	15: 82,131,737		probably benign	Het
Ccr3	C	T	9: 124,029,024	T132I	probably damaging	Het
Chaf1a	T	A	17: 56,047,384	I218K	unknown	Het
Ddx23	A	G	15: 98,656,600		probably null	Het
Dmkn	A	G	7: 30,765,294	S231G	probably benign	Het
Ep300	T	C	15: 81,641,313	I1446T	unknown	Het
Fmnl1	T	C	11: 103,189,969	F318S	probably damaging	Het
Grik5	A	T	7: 25,023,380	V497E	probably damaging	Het
Gtf2ird2	T	C	5: 134,214,083	Y380H	probably damaging	Het
Hecw2	C	T	1: 53,868,831		probably benign	Het
Hspb7	A	G	4: 141,424,047	I167V	probably damaging	Het
Kcnh2	T	A	5: 24,322,702	N884I	probably benign	Het
Krba1	T	C	6: 48,405,225		probably benign	Het
Krt18	G	T	15: 102,030,974	R294L	probably benign	Het
Lctl	T	A	9: 64,122,107	M1K	probably null	Het
Lingo2	G	A	4: 35,708,375	S535F	possibly damaging	Het
Lrba	A	C	3: 86,542,688	N2105H	probably damaging	Het
Lrrc10	A	G	10: 117,045,514	D31G	probably damaging	Het
Lrrtm1	T	A	6: 77,243,872	V104E	probably damaging	Het
Mgat3	C	T	15: 80,212,577	T535I	probably benign	Het
Nav3	T	C	10: 109,716,642	I1780V	possibly damaging	Het
Nlrc4	A	G	17: 74,446,831	W186R	probably damaging	Het
Nr2c1	T	A	10: 94,188,255	F441I	probably benign	Het
Obscn	A	G	11: 59,051,521		probably benign	Het
Olfr221	T	C	14: 52,035,985	N42S	possibly damaging	Het
Olfr444	T	C	6: 42,955,773	S92P	probably benign	Het
Olfr59	T	C	11: 74,288,675	F10L	probably benign	Het
Olfr688	T	C	7: 105,288,519	V142A	probably damaging	Het
Osr1	A	T	12: 9,579,691	Y188F	probably damaging	Het
Pak2	A	T	16: 32,033,843	N293K	possibly damaging	Het
Pappa	A	T	4: 65,307,812	T1301S	probably damaging	Het
Pde4dip	G	A	3: 97,753,126	Q679*	probably null	Het
Pik3r5	T	A	11: 68,486,622		probably null	Het
Plbd2	C	T	5: 120,486,039		probably null	Het
Ppp1r3a	G	T	6: 14,754,517	P244T	possibly damaging	Het
Pum1	C	A	4: 130,772,674	R960S	probably benign	Het
Ralgapb	T	C	2: 158,473,249	Y845H	probably damaging	Het
Rbms1	A	T	2: 60,758,835	M287K	possibly damaging	Het
Rdh1	A	T	10: 127,760,037	I34F	probably damaging	Het
Rgl3	T	A	9: 21,974,102	Q644L	probably benign	Het
Rpap2	T	C	5: 107,620,474	S393P	probably damaging	Het
Rsad2	T	C	12: 26,456,377	S15G	probably damaging	Het
Rspo1	G	A	4: 124,991,397	R22Q	probably benign	Het
S100a11	A	C	3: 93,524,202		probably null	Het
Sept4	T	C	11: 87,581,196	S11P	probably benign	Het
Serpina1c	T	C	12: 103,896,091	S322G	probably benign	Het
Setdb1	A	T	3: 95,341,451	C385S	probably damaging	Het
Shank2	A	T	7: 144,192,467	I193F	possibly damaging	Het
Slc4a11	G	T	2: 130,686,301		probably benign	Het
Snrnp40	C	G	4: 130,378,043		probably null	Het
Tbcd	C	A	11: 121,594,274	Q761K	probably benign	Het
Tmed6	C	T	8: 107,065,566	V16M	probably damaging	Het
Tmem229a	T	C	6: 24,955,702	T18A	probably benign	Het
Tsc1	T	A	2: 28,678,943		probably benign	Het
Ube2m	T	C	7: 13,035,730	N49D	probably damaging	Het
Ubqlnl	T	C	7: 104,150,047	D81G	probably damaging	Het
Vmn2r56	A	G	7: 12,715,405	V302A	probably benign	Het
Vmn2r73	T	A	7: 85,875,867	R24S	probably benign	Het
Wfs1	C	A	5: 36,973,194	S236I	probably damaging	Het
Xpot	A	T	10: 121,605,639	N560K	probably benign	Het
Yipf3	A	G	17: 46,251,577	T303A	probably benign	Het
Zfp790	T	C	7: 29,824,875	W19R	probably damaging	Het
Zfp846	T	C	9: 20,594,007	C388R	probably benign	Het
Zpr1	T	A	9: 46,273,336	I47N	probably damaging	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74919183	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74911078	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74927194	missense	probably benign
IGL01780:Cfap65	APN	1	74928348	nonsense	probably null
IGL01993:Cfap65	APN	1	74920543	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74928145	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74928348	nonsense	probably null
IGL02357:Cfap65	APN	1	74928348	nonsense	probably null
IGL02576:Cfap65	APN	1	74903458	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74905080	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74927178	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74911108	nonsense	probably null
IGL03101:Cfap65	APN	1	74928433	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74927619	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74904642	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74928342	missense	probably benign	0.05
R0227:Cfap65	UTSW	1	74931958	nonsense	probably null
R0281:Cfap65	UTSW	1	74927071	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74904067	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929301	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74929302	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74926444	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74920601	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74925440	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74916884	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74918444	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74902169	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74918887	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74904682	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74921519	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74902447	missense	probably damaging	0.98
R1079:Cfap65	UTSW	1	74905713	missense	probably damaging	0.99
R1083:Cfap65	UTSW	1	74918504	splice site	probably benign
R1159:Cfap65	UTSW	1	74929340	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74925104	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74917175	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74918948	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74907660	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74917199	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74907691	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74917273	frame shift	probably null
R2219:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74904025	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74926475	missense	probably damaging	1.00
R2417:Cfap65	UTSW	1	74927186	small insertion	probably benign
R3114:Cfap65	UTSW	1	74927132	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74920542	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74927681	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74903358	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74907612	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74904056	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74925354	intron	probably benign
R4701:Cfap65	UTSW	1	74918908	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74928361	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74927632	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74917295	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74925557	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74919261	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74907613	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74903124	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74906336	nonsense	probably null
R5074:Cfap65	UTSW	1	74922978	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74906441	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74926516	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74924902	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74903175	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74925100	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74907518	intron	probably benign
R5669:Cfap65	UTSW	1	74924968	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74923031	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74920405	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74903139	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74927709	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74904685	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74917286	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74932021	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74925115	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74931899	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74926633	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74926604	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74921583	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74920426	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74926610	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74902434	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74933144	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74928368	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74926625	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74933162	missense	probably benign	0.05
R8344:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74917169	nonsense	probably null
R8431:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74928044	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74905937	missense	possibly damaging	0.88
RF009:Cfap65	UTSW	1	74905647	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74910747	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTCTGCAAGTAAGAAGGCCCCAC -3'
(R):5'- GGGACTTTCATCACCCCATAAGTGC -3'

Sequencing Primer
(F):5'- GGATTCTTCACACTGTACATGTTTTG -3'
(R):5'- TTTCATCACCCCATAAGTGCTAAAAG -3'

Posted On

2013-04-11