Incidental Mutation 'R1767:Adgrf5'
ID194522
Institutional Source Beutler Lab
Gene Symbol Adgrf5
Ensembl Gene ENSMUSG00000056492
Gene Nameadhesion G protein-coupled receptor F5
SynonymsGpr116, 8430401C09Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1767 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location43360451-43459557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43450564 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1050 (Y1050F)
Ref Sequence ENSEMBL: ENSMUSP00000153049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113599] [ENSMUST00000225962] [ENSMUST00000226087]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082648
Predicted Effect possibly damaging
Transcript: ENSMUST00000113599
AA Change: Y1050F

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492
AA Change: Y1050F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:EGF 118 161 8e-14 BLAST
Pfam:SEA 165 263 9.2e-14 PFAM
IG 276 366 1.54e-4 SMART
Blast:IG_like 374 464 2e-31 BLAST
IG 475 561 1.04e-1 SMART
low complexity region 815 823 N/A INTRINSIC
GPS 949 1004 6.49e-16 SMART
Pfam:7tm_2 1011 1264 1.2e-35 PFAM
low complexity region 1328 1347 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000225962
AA Change: Y845F

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000226087
AA Change: Y1050F

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110065P20Rik T C 4: 124,849,961 N128S possibly damaging Het
1700011H14Rik G A 14: 49,235,884 T128I probably benign Het
Adam26b T A 8: 43,519,911 I685F probably benign Het
Alcam A T 16: 52,270,714 N480K probably damaging Het
Alk T A 17: 71,900,698 H1014L possibly damaging Het
Arhgef2 A G 3: 88,643,953 Q778R probably damaging Het
Arhgef6 T C X: 57,338,562 M5V probably benign Het
Ascc3 T A 10: 50,718,376 I1189N probably damaging Het
AU040320 G A 4: 126,840,724 G713D probably damaging Het
Bmpr1a A G 14: 34,447,770 probably null Het
Bpifa6 A G 2: 153,987,227 T225A possibly damaging Het
Cacna1g T C 11: 94,459,802 S406G probably benign Het
Ccdc40 T A 11: 119,230,696 probably null Het
Cckbr A T 7: 105,434,551 I229F possibly damaging Het
Cers3 A G 7: 66,783,403 K156R probably damaging Het
Chd1 T A 17: 15,770,303 W1706R probably damaging Het
Col11a2 T A 17: 34,063,895 probably benign Het
Coq10b A G 1: 55,061,354 R66G probably damaging Het
Cpn2 A T 16: 30,259,667 Y405* probably null Het
Dis3 A T 14: 99,084,142 Y590N probably damaging Het
Dpy19l1 T C 9: 24,462,584 H270R probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Ephx1 C T 1: 180,994,677 G101S probably damaging Het
Flg A T 3: 93,279,913 Y224F possibly damaging Het
Focad G T 4: 88,357,468 V1105L unknown Het
Fzd1 A G 5: 4,756,812 Y257H probably benign Het
Gm11116 T C 5: 88,111,452 probably benign Het
Gm11938 G A 11: 99,603,245 S8F unknown Het
Gm9008 A T 6: 76,497,605 N9K unknown Het
Grin3a A T 4: 49,844,423 V220E probably damaging Het
Gstt2 T C 10: 75,834,264 D8G probably damaging Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Hook3 A G 8: 26,071,056 probably null Het
Itpr2 T C 6: 146,350,068 D993G possibly damaging Het
Jhy T C 9: 40,961,148 R22G probably benign Het
Krt13 A C 11: 100,121,100 H132Q possibly damaging Het
Krtap27-1 G A 16: 88,671,311 S115L probably damaging Het
L1td1 T C 4: 98,737,449 V627A probably benign Het
Lrrn4cl A G 19: 8,851,771 T38A probably benign Het
Ly96 A G 1: 16,706,175 T112A probably benign Het
Meltf G T 16: 31,883,929 C158F probably damaging Het
Mycbp2 A T 14: 103,248,405 H1040Q probably damaging Het
Npas4 G A 19: 4,988,183 P199L probably benign Het
Olfr1087 A G 2: 86,690,384 M197T probably benign Het
Olfr530 T C 7: 140,373,476 I45V possibly damaging Het
Olfr569 T A 7: 102,887,626 I176F probably damaging Het
Pcdh10 A T 3: 45,384,177 H923L probably damaging Het
Pias3 T C 3: 96,701,403 S228P probably damaging Het
Pign A G 1: 105,653,192 V154A probably benign Het
Plod3 T A 5: 136,990,176 V305E possibly damaging Het
Prkra G T 2: 76,647,240 H40Q possibly damaging Het
Prss22 T A 17: 23,996,357 E148D probably benign Het
Psg17 A G 7: 18,816,802 V376A possibly damaging Het
Retnlg A T 16: 48,873,628 D49V possibly damaging Het
Rtp1 A G 16: 23,431,374 E163G probably damaging Het
Slc6a20a T A 9: 123,637,100 I522F probably damaging Het
Slco5a1 T C 1: 12,989,615 D294G probably damaging Het
Slco6d1 A G 1: 98,490,549 T487A possibly damaging Het
Smarcc2 A T 10: 128,469,082 D262V possibly damaging Het
Sned1 G A 1: 93,281,654 V830M possibly damaging Het
Ssbp3 G T 4: 107,047,415 D336Y probably damaging Het
Sun2 A G 15: 79,725,557 S694P probably benign Het
Tdp1 G A 12: 99,891,343 probably null Het
Tfap2a A T 13: 40,725,137 I204N probably damaging Het
Tfip11 T A 5: 112,334,432 W519R probably damaging Het
Tie1 T C 4: 118,476,176 E831G possibly damaging Het
Tjp1 A G 7: 65,312,553 probably null Het
Tln2 C T 9: 67,286,514 A1773T probably benign Het
Tmem39b A C 4: 129,693,183 I78M possibly damaging Het
Trank1 T C 9: 111,391,479 V2428A probably benign Het
Trim35 A G 14: 66,304,168 E247G probably damaging Het
Tsc22d1 T C 14: 76,418,102 S674P probably damaging Het
Tsn A T 1: 118,300,888 D201E probably damaging Het
Usp42 A T 5: 143,714,866 V1134E possibly damaging Het
Uvrag A G 7: 99,099,394 I117T probably damaging Het
Vmn1r192 A G 13: 22,187,271 S260P probably benign Het
Vmn2r110 C T 17: 20,580,578 A531T possibly damaging Het
Wdsub1 A T 2: 59,858,714 I388N probably damaging Het
Wnt10b A T 15: 98,772,675 L228Q probably damaging Het
Zbtb34 A C 2: 33,411,336 S398A possibly damaging Het
Other mutations in Adgrf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Adgrf5 APN 17 43449915 missense possibly damaging 0.79
IGL00590:Adgrf5 APN 17 43453147 missense probably damaging 1.00
IGL01128:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01131:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01132:Adgrf5 APN 17 43422509 missense possibly damaging 0.95
IGL01392:Adgrf5 APN 17 43450012 missense probably benign 0.00
IGL01475:Adgrf5 APN 17 43450354 missense probably benign 0.00
IGL01614:Adgrf5 APN 17 43424471 missense possibly damaging 0.53
IGL01654:Adgrf5 APN 17 43451170 missense possibly damaging 0.89
IGL02053:Adgrf5 APN 17 43450167 missense possibly damaging 0.47
IGL02175:Adgrf5 APN 17 43451010 missense probably damaging 1.00
IGL02416:Adgrf5 APN 17 43444980 splice site probably null
IGL02525:Adgrf5 APN 17 43449963 missense probably damaging 1.00
IGL03035:Adgrf5 APN 17 43430627 missense possibly damaging 0.80
duct_tape UTSW 17 43445115 missense probably benign 0.04
Flypaper UTSW 17 43422661 splice site probably benign
Heaped UTSW 17 43447036 missense possibly damaging 0.93
la_brea UTSW 17 43452323 critical splice donor site probably null
Motel UTSW 17 43450380 missense probably damaging 1.00
noel UTSW 17 43430612 missense probably damaging 1.00
Schmutzfinger UTSW 17 43424818 nonsense probably null
sticky UTSW 17 43437571 missense probably damaging 0.98
sweetie UTSW 17 43450983 missense probably damaging 0.96
PIT4812001:Adgrf5 UTSW 17 43450369 missense probably damaging 1.00
R0699:Adgrf5 UTSW 17 43422661 splice site probably null
R0972:Adgrf5 UTSW 17 43450983 missense probably damaging 0.96
R1521:Adgrf5 UTSW 17 43430552 missense probably benign 0.03
R1523:Adgrf5 UTSW 17 43450153 missense probably benign 0.00
R1758:Adgrf5 UTSW 17 43424593 critical splice donor site probably null
R1799:Adgrf5 UTSW 17 43440067 missense probably damaging 0.98
R1800:Adgrf5 UTSW 17 43451082 missense probably damaging 1.00
R1888:Adgrf5 UTSW 17 43427005 splice site probably null
R1888:Adgrf5 UTSW 17 43427005 splice site probably null
R2057:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2058:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2059:Adgrf5 UTSW 17 43428586 missense possibly damaging 0.88
R2410:Adgrf5 UTSW 17 43455266 missense probably benign 0.11
R2568:Adgrf5 UTSW 17 43437671 missense probably damaging 1.00
R2847:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R2848:Adgrf5 UTSW 17 43422640 missense possibly damaging 0.69
R3800:Adgrf5 UTSW 17 43447060 splice site probably benign
R3856:Adgrf5 UTSW 17 43447036 missense possibly damaging 0.93
R4021:Adgrf5 UTSW 17 43430714 splice site probably benign
R4075:Adgrf5 UTSW 17 43450195 missense probably damaging 1.00
R4366:Adgrf5 UTSW 17 43441969 missense probably damaging 0.99
R4409:Adgrf5 UTSW 17 43441847 missense probably damaging 1.00
R4570:Adgrf5 UTSW 17 43445115 missense probably benign 0.04
R4616:Adgrf5 UTSW 17 43452440 missense probably benign 0.38
R4623:Adgrf5 UTSW 17 43450983 missense probably benign 0.16
R4645:Adgrf5 UTSW 17 43437525 missense probably damaging 1.00
R5211:Adgrf5 UTSW 17 43422620 missense probably benign 0.32
R5268:Adgrf5 UTSW 17 43450999 missense probably damaging 1.00
R5280:Adgrf5 UTSW 17 43426334 missense probably damaging 1.00
R5326:Adgrf5 UTSW 17 43440074 missense probably damaging 0.98
R5762:Adgrf5 UTSW 17 43430695 missense probably null 0.16
R5856:Adgrf5 UTSW 17 43446120 missense probably benign 0.09
R6007:Adgrf5 UTSW 17 43437571 missense probably damaging 0.98
R6153:Adgrf5 UTSW 17 43451083 missense possibly damaging 0.96
R6451:Adgrf5 UTSW 17 43424818 nonsense probably null
R6535:Adgrf5 UTSW 17 43440029 missense probably benign 0.05
R6536:Adgrf5 UTSW 17 43422661 splice site probably benign
R6602:Adgrf5 UTSW 17 43450304 missense probably benign 0.32
R6882:Adgrf5 UTSW 17 43450380 missense probably damaging 1.00
R6992:Adgrf5 UTSW 17 43452323 critical splice donor site probably null
R7137:Adgrf5 UTSW 17 43450897 missense probably damaging 1.00
R7170:Adgrf5 UTSW 17 43446138 missense possibly damaging 0.92
R7313:Adgrf5 UTSW 17 43445083 missense probably benign 0.01
R7313:Adgrf5 UTSW 17 43452477 critical splice donor site probably null
R7331:Adgrf5 UTSW 17 43437593 missense probably damaging 0.99
R7346:Adgrf5 UTSW 17 43451179 missense probably damaging 1.00
R7350:Adgrf5 UTSW 17 43428444 critical splice acceptor site probably null
R7667:Adgrf5 UTSW 17 43446039 missense probably benign 0.01
R7717:Adgrf5 UTSW 17 43450753 missense probably damaging 1.00
R7731:Adgrf5 UTSW 17 43450560 missense probably damaging 1.00
R7877:Adgrf5 UTSW 17 43441838 missense possibly damaging 0.63
R7950:Adgrf5 UTSW 17 43451157 missense probably damaging 0.99
R7988:Adgrf5 UTSW 17 43439813 intron probably benign
R8188:Adgrf5 UTSW 17 43430612 missense probably damaging 1.00
R8219:Adgrf5 UTSW 17 43449859 missense probably benign 0.13
R8284:Adgrf5 UTSW 17 43455270 missense unknown
R8460:Adgrf5 UTSW 17 43439808 intron probably benign
R8504:Adgrf5 UTSW 17 43446949 missense probably benign 0.01
R8751:Adgrf5 UTSW 17 43437683 missense possibly damaging 0.80
R8852:Adgrf5 UTSW 17 43453098 missense possibly damaging 0.82
X0017:Adgrf5 UTSW 17 43427045 missense probably damaging 1.00
Z1177:Adgrf5 UTSW 17 43445053 missense probably benign 0.00
Z1191:Adgrf5 UTSW 17 43445035 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TCTGCAAGTGTAACCACCTGACG -3'
(R):5'- ATGGCAAAAGCCAGCAGTGCTC -3'

Sequencing Primer
(F):5'- ACGTCATTCTCCATCCTCATGTC -3'
(R):5'- GTAACCCCCACTGTGATAGAGG -3'
Posted On2014-05-23