Mutagenetix > Incidental Mutations

Incidental Mutation 'R1768:Spag17'

194544

Institutional Source

Beutler Lab

Gene Symbol

Spag17

Ensembl Gene

ENSMUSG00000027867

Gene Name

sperm associated antigen 17

Synonyms

4931427F14Rik, PF6

MMRRC Submission

039799-MU

Accession Numbers

Genbank: NM_028892; MGI: 1921612

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1768 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

99885406-100143322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 100027352 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 650 (Y650F)

Ref Sequence

ENSEMBL: ENSMUSP00000134066 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164539]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143050

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152586

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164539
AA Change: Y650F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: Y650F

Domain	Start	End	E-Value	Type
low complexity region	155	170	N/A	INTRINSIC
low complexity region	384	400	N/A	INTRINSIC
low complexity region	876	887	N/A	INTRINSIC
coiled coil region	909	964	N/A	INTRINSIC
coiled coil region	1079	1120	N/A	INTRINSIC
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1192	1205	N/A	INTRINSIC
low complexity region	1209	1220	N/A	INTRINSIC
low complexity region	1223	1238	N/A	INTRINSIC
low complexity region	1394	1405	N/A	INTRINSIC
low complexity region	1931	1942	N/A	INTRINSIC
Pfam:PapD-like	2171	2277	1.2e-15	PFAM

Meta Mutation Damage Score

0.0993

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

91% (107/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	G	C	18: 6,623,470	R60P	possibly damaging	Het
Aox2	T	A	1: 58,354,195	C1199S	probably benign	Het
Arhgap18	G	A	10: 26,887,861	M482I	probably damaging	Het
Arhgap18	G	T	10: 26,887,862	A483S	probably damaging	Het
Arid4a	G	A	12: 71,075,338	S509N	probably benign	Het
BC051019	T	C	7: 109,723,174	T38A	probably benign	Het
Bcam	T	C	7: 19,765,618	N192S	probably null	Het
Bend5	A	T	4: 111,454,241	K351*	probably null	Het
Bicdl2	T	A	17: 23,665,949	M208K	probably damaging	Het
Ccdc155	T	A	7: 45,188,803		probably null	Het
Ccp110	A	T	7: 118,726,024		probably null	Het
Cdc6	A	T	11: 98,912,217	T328S	probably damaging	Het
Cdk5rap2	G	T	4: 70,307,233	N558K	probably benign	Het
Cdkn1c	C	T	7: 143,459,121	R146K	probably benign	Het
Ceacam18	G	A	7: 43,648,494	C371Y	probably benign	Het
Cep95	T	A	11: 106,806,351	C233*	probably null	Het
Chrnd	A	G	1: 87,194,928	I144V	probably benign	Het
Col6a4	T	A	9: 106,080,100	Q175L	probably benign	Het
Cym	A	T	3: 107,213,500	V263E	probably damaging	Het
Cyp2a4	G	T	7: 26,312,772	V327F	possibly damaging	Het
Dhx29	T	A	13: 112,948,240	M664K	probably damaging	Het
Dlec1	T	G	9: 119,146,007		probably null	Het
Dna2	T	C	10: 62,957,084	Y293H	probably benign	Het
Dnase1l3	T	A	14: 7,974,104	N196Y	probably damaging	Het
Eea1	T	A	10: 95,996,960	D222E	probably damaging	Het
Efcab14	A	T	4: 115,752,919		probably null	Het
Entpd5	C	T	12: 84,386,211	R189H	probably benign	Het
Exoc4	A	T	6: 33,758,050	K534M	probably damaging	Het
Extl1	T	A	4: 134,371,138	Y194F	probably benign	Het
Eya1	A	G	1: 14,253,075	L161S	possibly damaging	Het
Fam163b	T	C	2: 27,112,862	E41G	possibly damaging	Het
Fam180a	A	C	6: 35,315,352	S40A	probably benign	Het
Fbxl4	T	C	4: 22,385,950	S186P	probably benign	Het
Fbxw19	A	T	9: 109,494,772	L45*	probably null	Het
Fgf14	G	T	14: 124,676,512	T69N	probably benign	Het
Flt1	A	G	5: 147,672,709	Y432H	probably damaging	Het
Frmd4b	A	T	6: 97,306,764	L374Q	possibly damaging	Het
G6pc2	T	A	2: 69,222,977	V125D	probably damaging	Het
Gna15	A	T	10: 81,512,120	L164Q	probably damaging	Het
Gnaz	C	A	10: 74,991,870	D151E	possibly damaging	Het
Has1	T	C	17: 17,850,300	T120A	probably benign	Het
Hectd4	T	A	5: 121,358,303	D3919E	possibly damaging	Het
Hs3st5	A	G	10: 36,833,169	I233M	probably benign	Het
Ilf3	T	C	9: 21,403,142		probably benign	Het
Inpp5b	T	A	4: 124,793,276	L765*	probably null	Het
Insr	A	T	8: 3,159,561	I1174N	probably damaging	Het
Kcnq3	A	G	15: 66,005,906	L445P	probably damaging	Het
Kctd20	A	T	17: 28,962,850	N159Y	probably damaging	Het
Kctd20	A	T	17: 28,966,781	D366V	probably damaging	Het
Klk15	T	C	7: 43,938,333		probably benign	Het
Lama4	T	G	10: 39,103,501	N1658K	possibly damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mas1	T	C	17: 12,841,699	Y279C	probably damaging	Het
Mast2	G	T	4: 116,306,959	D1747E	probably damaging	Het
Mest	G	A	6: 30,745,139	M235I	probably benign	Het
Mfsd6	A	G	1: 52,660,805		probably null	Het
Mllt10	T	A	2: 18,162,846	S449R	probably damaging	Het
Mon2	T	A	10: 123,013,763	T1211S	probably benign	Het
Mrnip	G	A	11: 50,176,861	C27Y	probably damaging	Het
Myh15	A	T	16: 49,163,135	T1538S	probably benign	Het
Nfatc2ip	A	G	7: 126,390,462	V250A	probably benign	Het
Npy1r	A	G	8: 66,704,525	D199G	possibly damaging	Het
Numbl	A	G	7: 27,280,954	T454A	probably benign	Het
Nutm2	T	G	13: 50,473,116	F436V	probably damaging	Het
Olfr1112	T	A	2: 87,191,698	S4T	probably benign	Het
Olfr330	A	G	11: 58,529,776	L70P	probably damaging	Het
Olfr458	A	G	6: 42,460,677	L114S	probably damaging	Het
Olfr556	A	G	7: 102,670,301	Y127C	probably damaging	Het
Olfr631	C	T	7: 103,929,725	R301*	probably null	Het
Olfr64	A	G	7: 103,893,277	S153P	probably benign	Het
Olfr676	A	G	7: 105,035,950	S251G	probably benign	Het
Olfr707	A	T	7: 106,891,977		probably null	Het
Olfr707	G	T	7: 106,891,978	L44M	probably damaging	Het
Olfr876	T	A	9: 37,804,303	Y131N	probably damaging	Het
Opa1	T	C	16: 29,620,810	S773P	probably benign	Het
Pde8a	G	C	7: 81,300,723		probably null	Het
Pgam1	T	C	19: 41,917,705	F232S	probably damaging	Het
Pgk1	T	A	X: 106,200,308	V303E	possibly damaging	Het
Pirb	A	T	7: 3,717,190	C395S	probably damaging	Het
Plxnc1	C	T	10: 94,844,322	V824I	probably benign	Het
Ppp6r1	A	G	7: 4,633,692		probably null	Het
Rapgef4	C	A	2: 72,225,787		probably benign	Het
Rars	T	A	11: 35,809,638	T539S	probably damaging	Het
Rbm44	G	T	1: 91,153,957		probably null	Het
RP23-114B10.6	T	C	8: 69,373,558	I119M	unknown	Het
Samd4b	A	G	7: 28,413,892	I216T	probably benign	Het
Serpine2	A	C	1: 79,816,815	F134V	probably damaging	Het
Shmt1	A	G	11: 60,792,964	Y341H	probably damaging	Het
Slc23a2	C	A	2: 132,075,641	V226F	probably benign	Het
Slc23a4	A	G	6: 34,956,961	I69T	probably damaging	Het
Slc37a1	C	A	17: 31,333,678	T319K	possibly damaging	Het
Slc6a4	A	T	11: 77,013,252	T178S	probably damaging	Het
Smarca4	G	A	9: 21,701,183	A1588T	possibly damaging	Het
Stab2	C	T	10: 87,003,008	G65S	probably damaging	Het
Stambpl1	C	G	19: 34,226,721	N70K	probably damaging	Het
Stip1	C	A	19: 7,021,797	C471F	probably damaging	Het
Taf1	T	C	X: 101,540,894	S223P	probably benign	Het
Tchh	C	A	3: 93,443,575	N107K	possibly damaging	Het
Tenm3	A	C	8: 48,232,104	H2432Q	probably damaging	Het
Tmem243	A	G	5: 9,118,548	N110S	probably damaging	Het
Toe1	A	T	4: 116,804,879	I306F	probably benign	Het
Trank1	G	A	9: 111,392,927	V2911M	probably damaging	Het
Trpm4	A	G	7: 45,308,612	I811T	probably damaging	Het
Tspear	T	A	10: 77,875,116		probably null	Het
Ttc28	A	T	5: 111,277,168	I1589F	possibly damaging	Het
Tubgcp3	A	G	8: 12,649,686		probably benign	Het
U2af2	C	A	7: 5,067,545	R78S	probably benign	Het
Wdr17	A	T	8: 54,673,654	D388E	possibly damaging	Het
Wdr3	A	T	3: 100,153,870	S261T	probably benign	Het
Zfp667	A	G	7: 6,305,067	N245D	possibly damaging	Het
Zfp692	A	G	11: 58,310,176		probably benign	Het
Zfp729a	T	C	13: 67,619,251	H953R	probably benign	Het

Other mutations in Spag17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01096:Spag17	APN	3	100063375	missense	probably benign	0.00
IGL01143:Spag17	APN	3	99939298	missense	probably benign	0.00
IGL01329:Spag17	APN	3	100095549	missense	probably benign	0.16
IGL01393:Spag17	APN	3	100027610	missense	possibly damaging	0.53
IGL01617:Spag17	APN	3	100109508	missense	possibly damaging	0.65
IGL01705:Spag17	APN	3	100022730	missense	probably benign	0.01
IGL01928:Spag17	APN	3	99940074	splice site	probably benign
IGL01981:Spag17	APN	3	100058833	missense	probably benign	0.03
IGL02435:Spag17	APN	3	99982444	missense	possibly damaging	0.53
IGL02452:Spag17	APN	3	100027391	missense	probably benign	0.00
IGL02465:Spag17	APN	3	100075871	missense	probably damaging	0.96
IGL02615:Spag17	APN	3	100072085	missense	probably benign	0.09
IGL02751:Spag17	APN	3	100010794	nonsense	probably null
IGL02803:Spag17	APN	3	100109397	missense	probably benign
IGL02898:Spag17	APN	3	100101386	missense	probably benign	0.00
IGL03037:Spag17	APN	3	100072170	splice site	probably null
IGL03068:Spag17	APN	3	100080205	missense	probably benign	0.35
IGL03131:Spag17	APN	3	100010759	missense	possibly damaging	0.85
IGL03224:Spag17	APN	3	100010840	missense	possibly damaging	0.53
FR4342:Spag17	UTSW	3	100056249	small insertion	probably benign
FR4342:Spag17	UTSW	3	100056252	small insertion	probably benign
FR4548:Spag17	UTSW	3	100056254	small insertion	probably benign
FR4589:Spag17	UTSW	3	100056245	small insertion	probably benign
FR4589:Spag17	UTSW	3	100056258	small insertion	probably benign
FR4737:Spag17	UTSW	3	100056257	small insertion	probably benign
FR4976:Spag17	UTSW	3	100056254	small insertion	probably benign
FR4976:Spag17	UTSW	3	100056255	small insertion	probably benign
N/A:Spag17	UTSW	3	99982254	splice site	probably benign
PIT4504001:Spag17	UTSW	3	100103110	critical splice acceptor site	probably null
PIT4514001:Spag17	UTSW	3	100013211	missense	possibly damaging	0.53
R0107:Spag17	UTSW	3	100050787	missense	possibly damaging	0.72
R0230:Spag17	UTSW	3	100106827	missense	probably benign	0.08
R0243:Spag17	UTSW	3	100085368	missense	probably benign	0.04
R0321:Spag17	UTSW	3	100101403	missense	probably damaging	0.99
R0375:Spag17	UTSW	3	100027590	missense	probably benign
R0417:Spag17	UTSW	3	100065554	missense	probably benign	0.11
R0490:Spag17	UTSW	3	99982411	missense	probably damaging	0.97
R0537:Spag17	UTSW	3	100125302	missense	probably damaging	0.98
R0714:Spag17	UTSW	3	100080156	missense	probably damaging	0.97
R0844:Spag17	UTSW	3	100004785	missense	probably benign
R0919:Spag17	UTSW	3	100071943	splice site	probably benign
R0926:Spag17	UTSW	3	100072116	missense	probably benign
R1037:Spag17	UTSW	3	100103117	missense	probably benign	0.01
R1075:Spag17	UTSW	3	100093676	missense	probably damaging	0.99
R1109:Spag17	UTSW	3	100027351	missense	possibly damaging	0.86
R1213:Spag17	UTSW	3	100095638	missense	probably benign	0.01
R1221:Spag17	UTSW	3	99982268	missense	possibly damaging	0.72
R1576:Spag17	UTSW	3	99939363	missense	possibly damaging	0.73
R1586:Spag17	UTSW	3	100021752	missense	possibly damaging	0.53
R1782:Spag17	UTSW	3	100010754	missense	probably benign	0.02
R1789:Spag17	UTSW	3	99939356	missense	possibly damaging	0.73
R1945:Spag17	UTSW	3	99939982	missense	probably benign
R2065:Spag17	UTSW	3	100013208	missense	probably benign	0.03
R2118:Spag17	UTSW	3	100049240	missense	possibly damaging	0.72
R2265:Spag17	UTSW	3	100061866	splice site	probably null
R2266:Spag17	UTSW	3	100061866	splice site	probably null
R2267:Spag17	UTSW	3	100061866	splice site	probably null
R2268:Spag17	UTSW	3	100061866	splice site	probably null
R2271:Spag17	UTSW	3	100106797	missense	probably damaging	1.00
R2389:Spag17	UTSW	3	100106837	missense	probably benign	0.27
R2420:Spag17	UTSW	3	100027619	missense	probably benign
R2422:Spag17	UTSW	3	100027619	missense	probably benign
R2423:Spag17	UTSW	3	100103456	missense	probably benign
R3407:Spag17	UTSW	3	100085299	missense	probably benign	0.09
R3801:Spag17	UTSW	3	100053853	missense	possibly damaging	0.53
R3856:Spag17	UTSW	3	100106759	missense	probably damaging	1.00
R4021:Spag17	UTSW	3	100049230	missense	probably benign	0.00
R4022:Spag17	UTSW	3	100049230	missense	probably benign	0.00
R4408:Spag17	UTSW	3	100103378	missense	probably benign
R4468:Spag17	UTSW	3	100085366	missense	probably damaging	0.98
R4540:Spag17	UTSW	3	100088381	missense	probably damaging	1.00
R4621:Spag17	UTSW	3	100103243	missense	probably benign	0.08
R4622:Spag17	UTSW	3	100103243	missense	probably benign	0.08
R4756:Spag17	UTSW	3	100103385	missense	possibly damaging	0.68
R4797:Spag17	UTSW	3	99984479	missense	possibly damaging	0.70
R4855:Spag17	UTSW	3	100063333	missense	probably benign	0.02
R4887:Spag17	UTSW	3	100050831	missense	probably damaging	1.00
R4962:Spag17	UTSW	3	100027623	missense	probably benign
R5030:Spag17	UTSW	3	100085341	nonsense	probably null
R5042:Spag17	UTSW	3	100072149	missense	probably damaging	1.00
R5074:Spag17	UTSW	3	100080118	missense	possibly damaging	0.94
R5195:Spag17	UTSW	3	100101388	missense	probably benign	0.16
R5200:Spag17	UTSW	3	100063471	nonsense	probably null
R5267:Spag17	UTSW	3	100061948	missense	probably damaging	0.98
R5360:Spag17	UTSW	3	100109410	missense	probably benign	0.00
R5444:Spag17	UTSW	3	100056152	missense	probably benign	0.06
R5498:Spag17	UTSW	3	100103345	missense	possibly damaging	0.83
R5503:Spag17	UTSW	3	100027244	missense	possibly damaging	0.72
R5540:Spag17	UTSW	3	100056272	missense	possibly damaging	0.91
R5547:Spag17	UTSW	3	100056152	missense	probably benign	0.06
R5575:Spag17	UTSW	3	100053822	missense	possibly damaging	0.85
R5629:Spag17	UTSW	3	100080119	missense	probably benign	0.33
R5639:Spag17	UTSW	3	100056166	missense	probably damaging	1.00
R5842:Spag17	UTSW	3	99939250	missense	possibly damaging	0.85
R5976:Spag17	UTSW	3	100095791	nonsense	probably null
R6082:Spag17	UTSW	3	100124185	missense	possibly damaging	0.46
R6228:Spag17	UTSW	3	100022602	missense	probably benign	0.33
R6254:Spag17	UTSW	3	100065585	missense	probably benign	0.03
R6321:Spag17	UTSW	3	100088427	missense	probably benign	0.05
R6446:Spag17	UTSW	3	100103132	missense	probably benign
R6687:Spag17	UTSW	3	100092950	missense	probably benign	0.07
R6853:Spag17	UTSW	3	100013235	missense	possibly damaging	0.86
R6946:Spag17	UTSW	3	100004683	missense	possibly damaging	0.53
R6953:Spag17	UTSW	3	100034975	missense	possibly damaging	0.53
R7038:Spag17	UTSW	3	99984609	missense	probably benign	0.00
R7084:Spag17	UTSW	3	99939270	missense	probably benign	0.18
R7126:Spag17	UTSW	3	100101435	missense	probably benign	0.00
R7144:Spag17	UTSW	3	100027401	splice site	probably null
R7198:Spag17	UTSW	3	100095572	missense	probably benign	0.02
R7318:Spag17	UTSW	3	99939983	missense	probably benign	0.00
R7403:Spag17	UTSW	3	99939375	missense	possibly damaging	0.53
R7409:Spag17	UTSW	3	100027231	missense	possibly damaging	0.73
R7409:Spag17	UTSW	3	100034159	missense	probably benign	0.00
R7537:Spag17	UTSW	3	99939247	missense	possibly damaging	0.96
R7609:Spag17	UTSW	3	100095595	nonsense	probably null
R7772:Spag17	UTSW	3	100080118	missense	probably damaging	0.98
X0025:Spag17	UTSW	3	100101451	missense	probably benign	0.31
Z1088:Spag17	UTSW	3	100095630	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- TGCACTAACAAGAGCCGTTCCC -3'
(R):5'- GAGTTGGAAGTAGAACCCGTCACAC -3'

Sequencing Primer
(F):5'- TTACAGAAGTTCTGAGCTGGAATG -3'
(R):5'- TAATAGCATCAGGCTCGTCAG -3'

Posted On

2014-05-23