Incidental Mutation 'R1768:Spag17'
ID 194544
Institutional Source Beutler Lab
Gene Symbol Spag17
Ensembl Gene ENSMUSG00000027867
Gene Name sperm associated antigen 17
Synonyms 4931427F14Rik, PF6
MMRRC Submission 039799-MU
Accession Numbers

Genbank: NM_028892; MGI: 1921612

Essential gene? Non essential (E-score: 0.000) question?
Stock # R1768 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 99885406-100143322 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100027352 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 650 (Y650F)
Ref Sequence ENSEMBL: ENSMUSP00000134066 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164539]
AlphaFold Q5S003
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152586
Predicted Effect possibly damaging
Transcript: ENSMUST00000164539
AA Change: Y650F

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134066
Gene: ENSMUSG00000027867
AA Change: Y650F

DomainStartEndE-ValueType
low complexity region 155 170 N/A INTRINSIC
low complexity region 384 400 N/A INTRINSIC
low complexity region 876 887 N/A INTRINSIC
coiled coil region 909 964 N/A INTRINSIC
coiled coil region 1079 1120 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1192 1205 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1223 1238 N/A INTRINSIC
low complexity region 1394 1405 N/A INTRINSIC
low complexity region 1931 1942 N/A INTRINSIC
Pfam:PapD-like 2171 2277 1.2e-15 PFAM
Meta Mutation Damage Score 0.0993 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 91% (107/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a central pair protein present in the axonemes of cells with a "9 + 2" organization of microtubules. The encoded protein is required for the proper function of the axoneme. Mutations in the orthologous gene in mice lead to primary ciliary dyskinesia characterized by immotile nasal and tracheal cilia, reduced clearance of nasal mucus, profound respiratory distress, hydrocephalus, and neonatal lethality within twelve hours of birth due to impaired airway mucociliary clearance. Single-nucleotide polymorphisms in this gene are associated with human height and targeted mutations lead to skeletal malformations affecting the limbs in mice, suggesting a role for this gene in skeletal development. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous null mice exhibit immotile respiratory cilia with axoneme structural defects, impaired mucociliary clearance, respiratory distress, pulmonary edema, disrupted alveolar epithelium, enlarged brain ventricles consistent with evolving hydrocephalus, failure to suckle, and neonatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,623,470 R60P possibly damaging Het
Aox2 T A 1: 58,354,195 C1199S probably benign Het
Arhgap18 G A 10: 26,887,861 M482I probably damaging Het
Arhgap18 G T 10: 26,887,862 A483S probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
BC051019 T C 7: 109,723,174 T38A probably benign Het
Bcam T C 7: 19,765,618 N192S probably null Het
Bend5 A T 4: 111,454,241 K351* probably null Het
Bicdl2 T A 17: 23,665,949 M208K probably damaging Het
Ccdc155 T A 7: 45,188,803 probably null Het
Ccp110 A T 7: 118,726,024 probably null Het
Cdc6 A T 11: 98,912,217 T328S probably damaging Het
Cdk5rap2 G T 4: 70,307,233 N558K probably benign Het
Cdkn1c C T 7: 143,459,121 R146K probably benign Het
Ceacam18 G A 7: 43,648,494 C371Y probably benign Het
Cep95 T A 11: 106,806,351 C233* probably null Het
Chrnd A G 1: 87,194,928 I144V probably benign Het
Col6a4 T A 9: 106,080,100 Q175L probably benign Het
Cym A T 3: 107,213,500 V263E probably damaging Het
Cyp2a4 G T 7: 26,312,772 V327F possibly damaging Het
Dhx29 T A 13: 112,948,240 M664K probably damaging Het
Dlec1 T G 9: 119,146,007 probably null Het
Dna2 T C 10: 62,957,084 Y293H probably benign Het
Dnase1l3 T A 14: 7,974,104 N196Y probably damaging Het
Eea1 T A 10: 95,996,960 D222E probably damaging Het
Efcab14 A T 4: 115,752,919 probably null Het
Entpd5 C T 12: 84,386,211 R189H probably benign Het
Exoc4 A T 6: 33,758,050 K534M probably damaging Het
Extl1 T A 4: 134,371,138 Y194F probably benign Het
Eya1 A G 1: 14,253,075 L161S possibly damaging Het
Fam163b T C 2: 27,112,862 E41G possibly damaging Het
Fam180a A C 6: 35,315,352 S40A probably benign Het
Fbxl4 T C 4: 22,385,950 S186P probably benign Het
Fbxw19 A T 9: 109,494,772 L45* probably null Het
Fgf14 G T 14: 124,676,512 T69N probably benign Het
Flt1 A G 5: 147,672,709 Y432H probably damaging Het
Frmd4b A T 6: 97,306,764 L374Q possibly damaging Het
G6pc2 T A 2: 69,222,977 V125D probably damaging Het
Gna15 A T 10: 81,512,120 L164Q probably damaging Het
Gnaz C A 10: 74,991,870 D151E possibly damaging Het
Has1 T C 17: 17,850,300 T120A probably benign Het
Hectd4 T A 5: 121,358,303 D3919E possibly damaging Het
Hs3st5 A G 10: 36,833,169 I233M probably benign Het
Ilf3 T C 9: 21,403,142 probably benign Het
Inpp5b T A 4: 124,793,276 L765* probably null Het
Insr A T 8: 3,159,561 I1174N probably damaging Het
Kcnq3 A G 15: 66,005,906 L445P probably damaging Het
Kctd20 A T 17: 28,962,850 N159Y probably damaging Het
Kctd20 A T 17: 28,966,781 D366V probably damaging Het
Klk15 T C 7: 43,938,333 probably benign Het
Lama4 T G 10: 39,103,501 N1658K possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mas1 T C 17: 12,841,699 Y279C probably damaging Het
Mast2 G T 4: 116,306,959 D1747E probably damaging Het
Mest G A 6: 30,745,139 M235I probably benign Het
Mfsd6 A G 1: 52,660,805 probably null Het
Mllt10 T A 2: 18,162,846 S449R probably damaging Het
Mon2 T A 10: 123,013,763 T1211S probably benign Het
Mrnip G A 11: 50,176,861 C27Y probably damaging Het
Myh15 A T 16: 49,163,135 T1538S probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Npy1r A G 8: 66,704,525 D199G possibly damaging Het
Numbl A G 7: 27,280,954 T454A probably benign Het
Nutm2 T G 13: 50,473,116 F436V probably damaging Het
Olfr1112 T A 2: 87,191,698 S4T probably benign Het
Olfr330 A G 11: 58,529,776 L70P probably damaging Het
Olfr458 A G 6: 42,460,677 L114S probably damaging Het
Olfr556 A G 7: 102,670,301 Y127C probably damaging Het
Olfr631 C T 7: 103,929,725 R301* probably null Het
Olfr64 A G 7: 103,893,277 S153P probably benign Het
Olfr676 A G 7: 105,035,950 S251G probably benign Het
Olfr707 A T 7: 106,891,977 probably null Het
Olfr707 G T 7: 106,891,978 L44M probably damaging Het
Olfr876 T A 9: 37,804,303 Y131N probably damaging Het
Opa1 T C 16: 29,620,810 S773P probably benign Het
Pde8a G C 7: 81,300,723 probably null Het
Pgam1 T C 19: 41,917,705 F232S probably damaging Het
Pgk1 T A X: 106,200,308 V303E possibly damaging Het
Pirb A T 7: 3,717,190 C395S probably damaging Het
Plxnc1 C T 10: 94,844,322 V824I probably benign Het
Ppp6r1 A G 7: 4,633,692 probably null Het
Rapgef4 C A 2: 72,225,787 probably benign Het
Rars T A 11: 35,809,638 T539S probably damaging Het
Rbm44 G T 1: 91,153,957 probably null Het
RP23-114B10.6 T C 8: 69,373,558 I119M unknown Het
Samd4b A G 7: 28,413,892 I216T probably benign Het
Serpine2 A C 1: 79,816,815 F134V probably damaging Het
Shmt1 A G 11: 60,792,964 Y341H probably damaging Het
Slc23a2 C A 2: 132,075,641 V226F probably benign Het
Slc23a4 A G 6: 34,956,961 I69T probably damaging Het
Slc37a1 C A 17: 31,333,678 T319K possibly damaging Het
Slc6a4 A T 11: 77,013,252 T178S probably damaging Het
Smarca4 G A 9: 21,701,183 A1588T possibly damaging Het
Stab2 C T 10: 87,003,008 G65S probably damaging Het
Stambpl1 C G 19: 34,226,721 N70K probably damaging Het
Stip1 C A 19: 7,021,797 C471F probably damaging Het
Taf1 T C X: 101,540,894 S223P probably benign Het
Tchh C A 3: 93,443,575 N107K possibly damaging Het
Tenm3 A C 8: 48,232,104 H2432Q probably damaging Het
Tmem243 A G 5: 9,118,548 N110S probably damaging Het
Toe1 A T 4: 116,804,879 I306F probably benign Het
Trank1 G A 9: 111,392,927 V2911M probably damaging Het
Trpm4 A G 7: 45,308,612 I811T probably damaging Het
Tspear T A 10: 77,875,116 probably null Het
Ttc28 A T 5: 111,277,168 I1589F possibly damaging Het
Tubgcp3 A G 8: 12,649,686 probably benign Het
U2af2 C A 7: 5,067,545 R78S probably benign Het
Wdr17 A T 8: 54,673,654 D388E possibly damaging Het
Wdr3 A T 3: 100,153,870 S261T probably benign Het
Zfp667 A G 7: 6,305,067 N245D possibly damaging Het
Zfp692 A G 11: 58,310,176 probably benign Het
Zfp729a T C 13: 67,619,251 H953R probably benign Het
Other mutations in Spag17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Spag17 APN 3 100063375 missense probably benign 0.00
IGL01143:Spag17 APN 3 99939298 missense probably benign 0.00
IGL01329:Spag17 APN 3 100095549 missense probably benign 0.16
IGL01393:Spag17 APN 3 100027610 missense possibly damaging 0.53
IGL01617:Spag17 APN 3 100109508 missense possibly damaging 0.65
IGL01705:Spag17 APN 3 100022730 missense probably benign 0.01
IGL01928:Spag17 APN 3 99940074 splice site probably benign
IGL01981:Spag17 APN 3 100058833 missense probably benign 0.03
IGL02435:Spag17 APN 3 99982444 missense possibly damaging 0.53
IGL02452:Spag17 APN 3 100027391 missense probably benign 0.00
IGL02465:Spag17 APN 3 100075871 missense probably damaging 0.96
IGL02615:Spag17 APN 3 100072085 missense probably benign 0.09
IGL02751:Spag17 APN 3 100010794 nonsense probably null
IGL02803:Spag17 APN 3 100109397 missense probably benign
IGL02898:Spag17 APN 3 100101386 missense probably benign 0.00
IGL03037:Spag17 APN 3 100072170 splice site probably null
IGL03068:Spag17 APN 3 100080205 missense probably benign 0.35
IGL03131:Spag17 APN 3 100010759 missense possibly damaging 0.85
IGL03224:Spag17 APN 3 100010840 missense possibly damaging 0.53
FR4342:Spag17 UTSW 3 100056249 small insertion probably benign
FR4342:Spag17 UTSW 3 100056252 small insertion probably benign
FR4548:Spag17 UTSW 3 100056254 small insertion probably benign
FR4589:Spag17 UTSW 3 100056245 small insertion probably benign
FR4589:Spag17 UTSW 3 100056258 small insertion probably benign
FR4737:Spag17 UTSW 3 100056257 small insertion probably benign
FR4976:Spag17 UTSW 3 100056254 small insertion probably benign
FR4976:Spag17 UTSW 3 100056255 small insertion probably benign
N/A:Spag17 UTSW 3 99982254 splice site probably benign
PIT4504001:Spag17 UTSW 3 100103110 critical splice acceptor site probably null
PIT4514001:Spag17 UTSW 3 100013211 missense possibly damaging 0.53
R0107:Spag17 UTSW 3 100050787 missense possibly damaging 0.72
R0230:Spag17 UTSW 3 100106827 missense probably benign 0.08
R0243:Spag17 UTSW 3 100085368 missense probably benign 0.04
R0321:Spag17 UTSW 3 100101403 missense probably damaging 0.99
R0375:Spag17 UTSW 3 100027590 missense probably benign
R0417:Spag17 UTSW 3 100065554 missense probably benign 0.11
R0490:Spag17 UTSW 3 99982411 missense probably damaging 0.97
R0537:Spag17 UTSW 3 100125302 missense probably damaging 0.98
R0714:Spag17 UTSW 3 100080156 missense probably damaging 0.97
R0844:Spag17 UTSW 3 100004785 missense probably benign
R0919:Spag17 UTSW 3 100071943 splice site probably benign
R0926:Spag17 UTSW 3 100072116 missense probably benign
R1037:Spag17 UTSW 3 100103117 missense probably benign 0.01
R1075:Spag17 UTSW 3 100093676 missense probably damaging 0.99
R1109:Spag17 UTSW 3 100027351 missense possibly damaging 0.86
R1213:Spag17 UTSW 3 100095638 missense probably benign 0.01
R1221:Spag17 UTSW 3 99982268 missense possibly damaging 0.72
R1576:Spag17 UTSW 3 99939363 missense possibly damaging 0.73
R1586:Spag17 UTSW 3 100021752 missense possibly damaging 0.53
R1782:Spag17 UTSW 3 100010754 missense probably benign 0.02
R1789:Spag17 UTSW 3 99939356 missense possibly damaging 0.73
R1945:Spag17 UTSW 3 99939982 missense probably benign
R2065:Spag17 UTSW 3 100013208 missense probably benign 0.03
R2118:Spag17 UTSW 3 100049240 missense possibly damaging 0.72
R2265:Spag17 UTSW 3 100061866 splice site probably null
R2266:Spag17 UTSW 3 100061866 splice site probably null
R2267:Spag17 UTSW 3 100061866 splice site probably null
R2268:Spag17 UTSW 3 100061866 splice site probably null
R2271:Spag17 UTSW 3 100106797 missense probably damaging 1.00
R2389:Spag17 UTSW 3 100106837 missense probably benign 0.27
R2420:Spag17 UTSW 3 100027619 missense probably benign
R2422:Spag17 UTSW 3 100027619 missense probably benign
R2423:Spag17 UTSW 3 100103456 missense probably benign
R3407:Spag17 UTSW 3 100085299 missense probably benign 0.09
R3801:Spag17 UTSW 3 100053853 missense possibly damaging 0.53
R3856:Spag17 UTSW 3 100106759 missense probably damaging 1.00
R4021:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4022:Spag17 UTSW 3 100049230 missense probably benign 0.00
R4408:Spag17 UTSW 3 100103378 missense probably benign
R4468:Spag17 UTSW 3 100085366 missense probably damaging 0.98
R4540:Spag17 UTSW 3 100088381 missense probably damaging 1.00
R4621:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4622:Spag17 UTSW 3 100103243 missense probably benign 0.08
R4756:Spag17 UTSW 3 100103385 missense possibly damaging 0.68
R4797:Spag17 UTSW 3 99984479 missense possibly damaging 0.70
R4855:Spag17 UTSW 3 100063333 missense probably benign 0.02
R4887:Spag17 UTSW 3 100050831 missense probably damaging 1.00
R4962:Spag17 UTSW 3 100027623 missense probably benign
R5030:Spag17 UTSW 3 100085341 nonsense probably null
R5042:Spag17 UTSW 3 100072149 missense probably damaging 1.00
R5074:Spag17 UTSW 3 100080118 missense possibly damaging 0.94
R5195:Spag17 UTSW 3 100101388 missense probably benign 0.16
R5200:Spag17 UTSW 3 100063471 nonsense probably null
R5267:Spag17 UTSW 3 100061948 missense probably damaging 0.98
R5360:Spag17 UTSW 3 100109410 missense probably benign 0.00
R5444:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5498:Spag17 UTSW 3 100103345 missense possibly damaging 0.83
R5503:Spag17 UTSW 3 100027244 missense possibly damaging 0.72
R5540:Spag17 UTSW 3 100056272 missense possibly damaging 0.91
R5547:Spag17 UTSW 3 100056152 missense probably benign 0.06
R5575:Spag17 UTSW 3 100053822 missense possibly damaging 0.85
R5629:Spag17 UTSW 3 100080119 missense probably benign 0.33
R5639:Spag17 UTSW 3 100056166 missense probably damaging 1.00
R5842:Spag17 UTSW 3 99939250 missense possibly damaging 0.85
R5976:Spag17 UTSW 3 100095791 nonsense probably null
R6082:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R6228:Spag17 UTSW 3 100022602 missense probably benign 0.33
R6254:Spag17 UTSW 3 100065585 missense probably benign 0.03
R6321:Spag17 UTSW 3 100088427 missense probably benign 0.05
R6446:Spag17 UTSW 3 100103132 missense probably benign
R6687:Spag17 UTSW 3 100092950 missense probably benign 0.07
R6853:Spag17 UTSW 3 100013235 missense possibly damaging 0.86
R6946:Spag17 UTSW 3 100004683 missense possibly damaging 0.53
R6953:Spag17 UTSW 3 100034975 missense possibly damaging 0.53
R7038:Spag17 UTSW 3 99984609 missense probably benign 0.00
R7084:Spag17 UTSW 3 99939270 missense probably benign 0.18
R7126:Spag17 UTSW 3 100101435 missense probably benign 0.00
R7144:Spag17 UTSW 3 100027401 splice site probably null
R7198:Spag17 UTSW 3 100095572 missense probably benign 0.02
R7318:Spag17 UTSW 3 99939983 missense probably benign 0.00
R7403:Spag17 UTSW 3 99939375 missense possibly damaging 0.53
R7409:Spag17 UTSW 3 100027231 missense possibly damaging 0.73
R7409:Spag17 UTSW 3 100034159 missense probably benign 0.00
R7537:Spag17 UTSW 3 99939247 missense possibly damaging 0.96
R7609:Spag17 UTSW 3 100095595 nonsense probably null
R7772:Spag17 UTSW 3 100080118 missense probably damaging 0.98
R7842:Spag17 UTSW 3 100053858 missense probably benign 0.18
R7963:Spag17 UTSW 3 100022638 missense probably benign 0.02
R8168:Spag17 UTSW 3 100034984 missense possibly damaging 0.96
R8291:Spag17 UTSW 3 100060850 missense probably benign
R8347:Spag17 UTSW 3 100027641 missense probably benign
R8383:Spag17 UTSW 3 100085392 missense probably damaging 0.98
R8474:Spag17 UTSW 3 100027270 missense probably benign 0.00
R8528:Spag17 UTSW 3 100124185 missense possibly damaging 0.46
R8804:Spag17 UTSW 3 99967190 missense probably benign
R8809:Spag17 UTSW 3 99982422 missense probably benign 0.33
R8818:Spag17 UTSW 3 100013227 missense probably benign 0.02
R8830:Spag17 UTSW 3 100125435 missense possibly damaging 0.77
R8890:Spag17 UTSW 3 100004678 missense possibly damaging 0.73
R9008:Spag17 UTSW 3 100027626 missense possibly damaging 0.73
R9095:Spag17 UTSW 3 100004776 missense possibly damaging 0.86
R9143:Spag17 UTSW 3 100027590 missense probably benign
R9182:Spag17 UTSW 3 100058842 missense possibly damaging 0.92
R9211:Spag17 UTSW 3 100125298 critical splice acceptor site probably benign
R9344:Spag17 UTSW 3 100103477 missense probably benign 0.01
R9354:Spag17 UTSW 3 100027589 missense probably benign
R9527:Spag17 UTSW 3 100063461 missense probably damaging 1.00
R9658:Spag17 UTSW 3 100027616 missense possibly damaging 0.93
R9738:Spag17 UTSW 3 100027210 missense possibly damaging 0.53
X0025:Spag17 UTSW 3 100101451 missense probably benign 0.31
Z1088:Spag17 UTSW 3 100095630 missense probably benign 0.09
Z1176:Spag17 UTSW 3 100012993 missense probably benign 0.18
Z1177:Spag17 UTSW 3 100088399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTAACAAGAGCCGTTCCC -3'
(R):5'- GAGTTGGAAGTAGAACCCGTCACAC -3'

Sequencing Primer
(F):5'- TTACAGAAGTTCTGAGCTGGAATG -3'
(R):5'- TAATAGCATCAGGCTCGTCAG -3'
Posted On 2014-05-23