Mutagenetix > Incidental Mutation

Incidental Mutation 'R1768:Hectd4'

194559

Institutional Source

Beutler Lab

Gene Symbol

Hectd4

Ensembl Gene

ENSMUSG00000042744

Gene Name

HECT domain E3 ubiquitin protein ligase 4

Synonyms

Gm15800

MMRRC Submission

039799-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.934) question?

Stock #

R1768 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

121220219-121368577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 121358303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 3919 (D3919E)

Ref Sequence

ENSEMBL: ENSMUSP00000048345 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042614]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000042614
AA Change: D3919E

PolyPhen 2 Score 0.705 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: D3919E

Domain	Start	End	E-Value	Type
low complexity region	224	234	N/A	INTRINSIC
low complexity region	266	282	N/A	INTRINSIC
low complexity region	553	564	N/A	INTRINSIC
low complexity region	725	735	N/A	INTRINSIC
low complexity region	1252	1265	N/A	INTRINSIC
coiled coil region	1372	1398	N/A	INTRINSIC
low complexity region	1551	1562	N/A	INTRINSIC
low complexity region	1725	1741	N/A	INTRINSIC
low complexity region	1892	1904	N/A	INTRINSIC
low complexity region	2656	2666	N/A	INTRINSIC
low complexity region	2857	2872	N/A	INTRINSIC
low complexity region	2901	2917	N/A	INTRINSIC
low complexity region	2921	2933	N/A	INTRINSIC
low complexity region	3232	3246	N/A	INTRINSIC
low complexity region	3275	3335	N/A	INTRINSIC
low complexity region	3441	3448	N/A	INTRINSIC
low complexity region	3473	3506	N/A	INTRINSIC
low complexity region	3512	3533	N/A	INTRINSIC
low complexity region	3540	3554	N/A	INTRINSIC
low complexity region	3794	3822	N/A	INTRINSIC
HECTc	4048	4412	4.78e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000104159

Meta Mutation Damage Score

0.1652

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

91% (107/117)

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	G	C	18: 6,623,470	R60P	possibly damaging	Het
Aox2	T	A	1: 58,354,195	C1199S	probably benign	Het
Arhgap18	G	A	10: 26,887,861	M482I	probably damaging	Het
Arhgap18	G	T	10: 26,887,862	A483S	probably damaging	Het
Arid4a	G	A	12: 71,075,338	S509N	probably benign	Het
BC051019	T	C	7: 109,723,174	T38A	probably benign	Het
Bcam	T	C	7: 19,765,618	N192S	probably null	Het
Bend5	A	T	4: 111,454,241	K351*	probably null	Het
Bicdl2	T	A	17: 23,665,949	M208K	probably damaging	Het
Ccdc155	T	A	7: 45,188,803		probably null	Het
Ccp110	A	T	7: 118,726,024		probably null	Het
Cdc6	A	T	11: 98,912,217	T328S	probably damaging	Het
Cdk5rap2	G	T	4: 70,307,233	N558K	probably benign	Het
Cdkn1c	C	T	7: 143,459,121	R146K	probably benign	Het
Ceacam18	G	A	7: 43,648,494	C371Y	probably benign	Het
Cep95	T	A	11: 106,806,351	C233*	probably null	Het
Chrnd	A	G	1: 87,194,928	I144V	probably benign	Het
Col6a4	T	A	9: 106,080,100	Q175L	probably benign	Het
Cym	A	T	3: 107,213,500	V263E	probably damaging	Het
Cyp2a4	G	T	7: 26,312,772	V327F	possibly damaging	Het
Dhx29	T	A	13: 112,948,240	M664K	probably damaging	Het
Dlec1	T	G	9: 119,146,007		probably null	Het
Dna2	T	C	10: 62,957,084	Y293H	probably benign	Het
Dnase1l3	T	A	14: 7,974,104	N196Y	probably damaging	Het
Eea1	T	A	10: 95,996,960	D222E	probably damaging	Het
Efcab14	A	T	4: 115,752,919		probably null	Het
Entpd5	C	T	12: 84,386,211	R189H	probably benign	Het
Exoc4	A	T	6: 33,758,050	K534M	probably damaging	Het
Extl1	T	A	4: 134,371,138	Y194F	probably benign	Het
Eya1	A	G	1: 14,253,075	L161S	possibly damaging	Het
Fam163b	T	C	2: 27,112,862	E41G	possibly damaging	Het
Fam180a	A	C	6: 35,315,352	S40A	probably benign	Het
Fbxl4	T	C	4: 22,385,950	S186P	probably benign	Het
Fbxw19	A	T	9: 109,494,772	L45*	probably null	Het
Fgf14	G	T	14: 124,676,512	T69N	probably benign	Het
Flt1	A	G	5: 147,672,709	Y432H	probably damaging	Het
Frmd4b	A	T	6: 97,306,764	L374Q	possibly damaging	Het
G6pc2	T	A	2: 69,222,977	V125D	probably damaging	Het
Gna15	A	T	10: 81,512,120	L164Q	probably damaging	Het
Gnaz	C	A	10: 74,991,870	D151E	possibly damaging	Het
Has1	T	C	17: 17,850,300	T120A	probably benign	Het
Hs3st5	A	G	10: 36,833,169	I233M	probably benign	Het
Ilf3	T	C	9: 21,403,142		probably benign	Het
Inpp5b	T	A	4: 124,793,276	L765*	probably null	Het
Insr	A	T	8: 3,159,561	I1174N	probably damaging	Het
Kcnq3	A	G	15: 66,005,906	L445P	probably damaging	Het
Kctd20	A	T	17: 28,962,850	N159Y	probably damaging	Het
Kctd20	A	T	17: 28,966,781	D366V	probably damaging	Het
Klk15	T	C	7: 43,938,333		probably benign	Het
Lama4	T	G	10: 39,103,501	N1658K	possibly damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mas1	T	C	17: 12,841,699	Y279C	probably damaging	Het
Mast2	G	T	4: 116,306,959	D1747E	probably damaging	Het
Mest	G	A	6: 30,745,139	M235I	probably benign	Het
Mfsd6	A	G	1: 52,660,805		probably null	Het
Mllt10	T	A	2: 18,162,846	S449R	probably damaging	Het
Mon2	T	A	10: 123,013,763	T1211S	probably benign	Het
Mrnip	G	A	11: 50,176,861	C27Y	probably damaging	Het
Myh15	A	T	16: 49,163,135	T1538S	probably benign	Het
Nfatc2ip	A	G	7: 126,390,462	V250A	probably benign	Het
Npy1r	A	G	8: 66,704,525	D199G	possibly damaging	Het
Numbl	A	G	7: 27,280,954	T454A	probably benign	Het
Nutm2	T	G	13: 50,473,116	F436V	probably damaging	Het
Olfr1112	T	A	2: 87,191,698	S4T	probably benign	Het
Olfr330	A	G	11: 58,529,776	L70P	probably damaging	Het
Olfr458	A	G	6: 42,460,677	L114S	probably damaging	Het
Olfr556	A	G	7: 102,670,301	Y127C	probably damaging	Het
Olfr631	C	T	7: 103,929,725	R301*	probably null	Het
Olfr64	A	G	7: 103,893,277	S153P	probably benign	Het
Olfr676	A	G	7: 105,035,950	S251G	probably benign	Het
Olfr707	A	T	7: 106,891,977		probably null	Het
Olfr707	G	T	7: 106,891,978	L44M	probably damaging	Het
Olfr876	T	A	9: 37,804,303	Y131N	probably damaging	Het
Opa1	T	C	16: 29,620,810	S773P	probably benign	Het
Pde8a	G	C	7: 81,300,723		probably null	Het
Pgam1	T	C	19: 41,917,705	F232S	probably damaging	Het
Pgk1	T	A	X: 106,200,308	V303E	possibly damaging	Het
Pirb	A	T	7: 3,717,190	C395S	probably damaging	Het
Plxnc1	C	T	10: 94,844,322	V824I	probably benign	Het
Ppp6r1	A	G	7: 4,633,692		probably null	Het
Rapgef4	C	A	2: 72,225,787		probably benign	Het
Rars	T	A	11: 35,809,638	T539S	probably damaging	Het
Rbm44	G	T	1: 91,153,957		probably null	Het
RP23-114B10.6	T	C	8: 69,373,558	I119M	unknown	Het
Samd4b	A	G	7: 28,413,892	I216T	probably benign	Het
Serpine2	A	C	1: 79,816,815	F134V	probably damaging	Het
Shmt1	A	G	11: 60,792,964	Y341H	probably damaging	Het
Slc23a2	C	A	2: 132,075,641	V226F	probably benign	Het
Slc23a4	A	G	6: 34,956,961	I69T	probably damaging	Het
Slc37a1	C	A	17: 31,333,678	T319K	possibly damaging	Het
Slc6a4	A	T	11: 77,013,252	T178S	probably damaging	Het
Smarca4	G	A	9: 21,701,183	A1588T	possibly damaging	Het
Spag17	A	T	3: 100,027,352	Y650F	possibly damaging	Het
Stab2	C	T	10: 87,003,008	G65S	probably damaging	Het
Stambpl1	C	G	19: 34,226,721	N70K	probably damaging	Het
Stip1	C	A	19: 7,021,797	C471F	probably damaging	Het
Taf1	T	C	X: 101,540,894	S223P	probably benign	Het
Tchh	C	A	3: 93,443,575	N107K	possibly damaging	Het
Tenm3	A	C	8: 48,232,104	H2432Q	probably damaging	Het
Tmem243	A	G	5: 9,118,548	N110S	probably damaging	Het
Toe1	A	T	4: 116,804,879	I306F	probably benign	Het
Trank1	G	A	9: 111,392,927	V2911M	probably damaging	Het
Trpm4	A	G	7: 45,308,612	I811T	probably damaging	Het
Tspear	T	A	10: 77,875,116		probably null	Het
Ttc28	A	T	5: 111,277,168	I1589F	possibly damaging	Het
Tubgcp3	A	G	8: 12,649,686		probably benign	Het
U2af2	C	A	7: 5,067,545	R78S	probably benign	Het
Wdr17	A	T	8: 54,673,654	D388E	possibly damaging	Het
Wdr3	A	T	3: 100,153,870	S261T	probably benign	Het
Zfp667	A	G	7: 6,305,067	N245D	possibly damaging	Het
Zfp692	A	G	11: 58,310,176		probably benign	Het
Zfp729a	T	C	13: 67,619,251	H953R	probably benign	Het

Other mutations in Hectd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Hectd4	APN	5	121363870	missense	possibly damaging	0.51
IGL00976:Hectd4	APN	5	121349106	missense	probably benign	0.18
IGL01085:Hectd4	APN	5	121331701	missense	probably damaging	1.00
IGL01112:Hectd4	APN	5	121306950	missense	probably benign	0.01
IGL01402:Hectd4	APN	5	121339417	splice site	probably benign
IGL01474:Hectd4	APN	5	121336649	missense	possibly damaging	0.53
IGL01503:Hectd4	APN	5	121318651	missense	probably benign	0.28
IGL01548:Hectd4	APN	5	121364660	missense	possibly damaging	0.71
IGL01656:Hectd4	APN	5	121322700	missense	probably damaging	0.99
IGL01756:Hectd4	APN	5	121344824	missense	probably benign	0.28
IGL01819:Hectd4	APN	5	121328418	missense	possibly damaging	0.85
IGL02080:Hectd4	APN	5	121366606	utr 3 prime	probably benign
IGL02488:Hectd4	APN	5	121292087	missense	probably benign	0.33
IGL02490:Hectd4	APN	5	121318613	missense	possibly damaging	0.82
IGL02558:Hectd4	APN	5	121344785	missense	probably benign	0.28
IGL02626:Hectd4	APN	5	121353881	missense	possibly damaging	0.86
IGL02649:Hectd4	APN	5	121349402	missense	possibly damaging	0.73
IGL02736:Hectd4	APN	5	121342719	missense	possibly damaging	0.73
IGL02861:Hectd4	APN	5	121307004	missense	possibly damaging	0.81
IGL02880:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02889:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02953:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL02969:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03031:Hectd4	APN	5	121348794	missense	possibly damaging	0.96
IGL03066:Hectd4	APN	5	121365053	missense	possibly damaging	0.93
IGL03160:Hectd4	APN	5	121259879	missense	probably benign
IGL03181:Hectd4	APN	5	121353958	missense	possibly damaging	0.91
IGL03265:Hectd4	APN	5	121259939	splice site	probably benign
IGL03375:Hectd4	APN	5	121328382	missense	possibly damaging	0.72
Achilles	UTSW	5	121307381	nonsense	probably null
agamemnon	UTSW	5	121253858	splice site	probably benign
clymnestra	UTSW	5	121334375	missense	possibly damaging	0.86
hector	UTSW	5	121315437	missense	probably damaging	1.00
helen	UTSW	5	121310663	missense	probably damaging	0.97
Merriwether	UTSW	5	121353551	missense	possibly damaging	0.53
PIT4466001:Hectd4	UTSW	5	121333060	critical splice donor site	probably null
R0018:Hectd4	UTSW	5	121254179	missense	possibly damaging	0.53
R0024:Hectd4	UTSW	5	121308576	missense	possibly damaging	0.92
R0030:Hectd4	UTSW	5	121262588	nonsense	probably null
R0080:Hectd4	UTSW	5	121349372	missense	probably benign	0.18
R0110:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0110:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0115:Hectd4	UTSW	5	121295506	splice site	probably benign
R0128:Hectd4	UTSW	5	121349243	missense	possibly damaging	0.86
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0131:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0132:Hectd4	UTSW	5	121333024	missense	probably benign	0.44
R0244:Hectd4	UTSW	5	121329605	missense	probably benign	0.33
R0281:Hectd4	UTSW	5	121254251	missense	possibly damaging	0.85
R0329:Hectd4	UTSW	5	121259864	missense	probably benign
R0410:Hectd4	UTSW	5	121286266	missense	possibly damaging	0.86
R0422:Hectd4	UTSW	5	121343082	splice site	probably null
R0442:Hectd4	UTSW	5	121323982	missense	possibly damaging	0.66
R0449:Hectd4	UTSW	5	121364590	splice site	probably null
R0469:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0469:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0481:Hectd4	UTSW	5	121295506	splice site	probably benign
R0510:Hectd4	UTSW	5	121281896	missense	possibly damaging	0.90
R0510:Hectd4	UTSW	5	121305673	missense	possibly damaging	0.53
R0520:Hectd4	UTSW	5	121331707	missense	possibly damaging	0.53
R0534:Hectd4	UTSW	5	121348476	missense	possibly damaging	0.96
R0603:Hectd4	UTSW	5	121304337	missense	possibly damaging	0.46
R0617:Hectd4	UTSW	5	121343232	splice site	probably benign
R0622:Hectd4	UTSW	5	121348625	missense	possibly damaging	0.53
R0626:Hectd4	UTSW	5	121277824	missense	probably benign	0.18
R0708:Hectd4	UTSW	5	121286463	critical splice donor site	probably null
R0710:Hectd4	UTSW	5	121336628	missense	probably benign	0.08
R0763:Hectd4	UTSW	5	121307033	unclassified	probably benign
R0764:Hectd4	UTSW	5	121286769	missense	possibly damaging	0.46
R1123:Hectd4	UTSW	5	121286736	missense	probably damaging	0.96
R1129:Hectd4	UTSW	5	121310599	missense	possibly damaging	0.66
R1204:Hectd4	UTSW	5	121350485	missense	possibly damaging	0.85
R1237:Hectd4	UTSW	5	121321507	missense	possibly damaging	0.90
R1257:Hectd4	UTSW	5	121318624	nonsense	probably null
R1391:Hectd4	UTSW	5	121353695	missense	possibly damaging	0.96
R1395:Hectd4	UTSW	5	121328513	critical splice donor site	probably null
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1468:Hectd4	UTSW	5	121349172	missense	possibly damaging	0.65
R1545:Hectd4	UTSW	5	121323956	missense	possibly damaging	0.87
R1553:Hectd4	UTSW	5	121349259	missense	probably benign	0.00
R1572:Hectd4	UTSW	5	121301878	missense	possibly damaging	0.85
R1662:Hectd4	UTSW	5	121317245	missense	probably benign	0.01
R1705:Hectd4	UTSW	5	121298104	missense	probably benign
R1715:Hectd4	UTSW	5	121344818	missense	possibly damaging	0.85
R1728:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1736:Hectd4	UTSW	5	121349530	missense	possibly damaging	0.53
R1775:Hectd4	UTSW	5	121291191	splice site	probably benign
R1784:Hectd4	UTSW	5	121301839	missense	possibly damaging	0.51
R1843:Hectd4	UTSW	5	121297180	missense	possibly damaging	0.53
R1914:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R1915:Hectd4	UTSW	5	121322294	missense	probably benign	0.08
R2024:Hectd4	UTSW	5	121281918	missense	possibly damaging	0.86
R2103:Hectd4	UTSW	5	121355629	missense	probably benign	0.04
R2108:Hectd4	UTSW	5	121333424	missense	possibly damaging	0.72
R2124:Hectd4	UTSW	5	121318639	missense	probably damaging	0.97
R2150:Hectd4	UTSW	5	121253858	splice site	probably benign
R2192:Hectd4	UTSW	5	121315143	missense	possibly damaging	0.46
R2301:Hectd4	UTSW	5	121353537	missense	probably benign	0.18
R2324:Hectd4	UTSW	5	121315437	missense	probably damaging	1.00
R2331:Hectd4	UTSW	5	121320026	missense	probably benign	0.05
R2504:Hectd4	UTSW	5	121220620	missense	unknown
R2504:Hectd4	UTSW	5	121263967	missense	possibly damaging	0.73
R2904:Hectd4	UTSW	5	121292724	splice site	probably benign
R3843:Hectd4	UTSW	5	121259873	missense	possibly damaging	0.72
R3934:Hectd4	UTSW	5	121320101	critical splice donor site	probably null
R3944:Hectd4	UTSW	5	121303525	splice site	probably benign
R4133:Hectd4	UTSW	5	121277834	critical splice donor site	probably null
R4271:Hectd4	UTSW	5	121220504	small deletion	probably benign
R4413:Hectd4	UTSW	5	121350481	missense	possibly damaging	0.53
R4456:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R4489:Hectd4	UTSW	5	121286257	missense	possibly damaging	0.73
R4539:Hectd4	UTSW	5	121314907	nonsense	probably null
R4564:Hectd4	UTSW	5	121350431	missense	probably benign	0.33
R4582:Hectd4	UTSW	5	121286419	missense	possibly damaging	0.53
R4629:Hectd4	UTSW	5	121297203	missense	probably benign	0.01
R4633:Hectd4	UTSW	5	121349216	missense	probably benign	0.33
R4643:Hectd4	UTSW	5	121349055	missense	possibly damaging	0.53
R4679:Hectd4	UTSW	5	121325251	missense	possibly damaging	0.72
R4681:Hectd4	UTSW	5	121303615	missense	possibly damaging	0.86
R4734:Hectd4	UTSW	5	121341977	missense	possibly damaging	0.53
R4739:Hectd4	UTSW	5	121348442	missense	probably benign
R4781:Hectd4	UTSW	5	121306107	critical splice donor site	probably null
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4860:Hectd4	UTSW	5	121305818	missense	probably benign	0.04
R4869:Hectd4	UTSW	5	121322672	missense	possibly damaging	0.46
R4909:Hectd4	UTSW	5	121263891	missense	probably benign	0.18
R4922:Hectd4	UTSW	5	121359315	missense	possibly damaging	0.86
R4925:Hectd4	UTSW	5	121322690	missense	possibly damaging	0.83
R5004:Hectd4	UTSW	5	121328199	splice site	probably null
R5004:Hectd4	UTSW	5	121329565	missense	possibly damaging	0.93
R5129:Hectd4	UTSW	5	121343510	missense	possibly damaging	0.87
R5217:Hectd4	UTSW	5	121353551	missense	possibly damaging	0.53
R5267:Hectd4	UTSW	5	121344824	missense	probably benign	0.28
R5344:Hectd4	UTSW	5	121343676	missense	probably benign	0.28
R5345:Hectd4	UTSW	5	121263974	missense	possibly damaging	0.85
R5347:Hectd4	UTSW	5	121304448	missense	probably benign	0.33
R5360:Hectd4	UTSW	5	121315401	missense	possibly damaging	0.90
R5363:Hectd4	UTSW	5	121310603	missense	probably benign	0.04
R5445:Hectd4	UTSW	5	121266274	missense	probably benign	0.00
R5479:Hectd4	UTSW	5	121306948	missense	probably benign
R5507:Hectd4	UTSW	5	121281101	missense	unknown
R5552:Hectd4	UTSW	5	121342851	missense	possibly damaging	0.96
R5691:Hectd4	UTSW	5	121348815	missense	possibly damaging	0.85
R5745:Hectd4	UTSW	5	121353502	missense	possibly damaging	0.96
R5757:Hectd4	UTSW	5	121348619	missense	possibly damaging	0.72
R5845:Hectd4	UTSW	5	121307524	critical splice donor site	probably null
R5869:Hectd4	UTSW	5	121343225	critical splice donor site	probably null
R5913:Hectd4	UTSW	5	121323974	missense	possibly damaging	0.83
R5920:Hectd4	UTSW	5	121308271	missense	possibly damaging	0.65
R5943:Hectd4	UTSW	5	121322294	missense	probably benign	0.01
R6219:Hectd4	UTSW	5	121308878	missense	possibly damaging	0.92
R6250:Hectd4	UTSW	5	121339498	missense	possibly damaging	0.85
R6301:Hectd4	UTSW	5	121254220	missense	possibly damaging	0.91
R6428:Hectd4	UTSW	5	121350445	missense	possibly damaging	0.53
R6446:Hectd4	UTSW	5	121334375	missense	possibly damaging	0.86
R6453:Hectd4	UTSW	5	121350592	missense	probably damaging	1.00
R6513:Hectd4	UTSW	5	121356196	splice site	probably null
R6540:Hectd4	UTSW	5	121303571	missense	probably benign	0.33
R6706:Hectd4	UTSW	5	121320084	missense	possibly damaging	0.92
R6720:Hectd4	UTSW	5	121307381	nonsense	probably null
R6736:Hectd4	UTSW	5	121277725	missense	possibly damaging	0.86
R6776:Hectd4	UTSW	5	121353511	missense	possibly damaging	0.85
R7033:Hectd4	UTSW	5	121364568	missense	possibly damaging	0.86
R7038:Hectd4	UTSW	5	121299597	missense	possibly damaging	0.90
R7175:Hectd4	UTSW	5	121273629	missense	possibly damaging	0.85
R7180:Hectd4	UTSW	5	121308342	missense	probably benign	0.01
R7234:Hectd4	UTSW	5	121329073	missense	possibly damaging	0.53
R7253:Hectd4	UTSW	5	121314881	missense	possibly damaging	0.66
R7349:Hectd4	UTSW	5	121310663	missense	probably damaging	0.97
R7450:Hectd4	UTSW	5	121281932	missense	probably benign	0.00
R7467:Hectd4	UTSW	5	121323961	missense	possibly damaging	0.66
R7475:Hectd4	UTSW	5	121358133	splice site	probably null
R7482:Hectd4	UTSW	5	121363878	missense	possibly damaging	0.71
R7512:Hectd4	UTSW	5	121297109	missense	possibly damaging	0.72
R7525:Hectd4	UTSW	5	121343665	missense	possibly damaging	0.70
R7559:Hectd4	UTSW	5	121315510	splice site	probably null
R7560:Hectd4	UTSW	5	121254342	missense	possibly damaging	0.53
R7561:Hectd4	UTSW	5	121291225	missense	possibly damaging	0.91
R7576:Hectd4	UTSW	5	121349459	missense	possibly damaging	0.91
R7584:Hectd4	UTSW	5	121318735	missense	possibly damaging	0.83
R7648:Hectd4	UTSW	5	121254371	missense	possibly damaging	0.73
R7663:Hectd4	UTSW	5	121324031	missense	probably benign	0.06
R7692:Hectd4	UTSW	5	121321564	missense	possibly damaging	0.46
R7725:Hectd4	UTSW	5	121220617	missense	unknown
R7731:Hectd4	UTSW	5	121307014	missense	probably benign	0.00
R7732:Hectd4	UTSW	5	121336629	missense	probably benign	0.14
R7782:Hectd4	UTSW	5	121305721	missense	possibly damaging	0.53
R7854:Hectd4	UTSW	5	121329568	missense	probably benign	0.27
R7898:Hectd4	UTSW	5	121331817	missense	probably benign	0.18
R7910:Hectd4	UTSW	5	121254228	missense	possibly damaging	0.86
R7962:Hectd4	UTSW	5	121310629	missense	probably damaging	0.98
R8003:Hectd4	UTSW	5	121339518	missense	possibly damaging	0.85
R8098:Hectd4	UTSW	5	121321398	missense	possibly damaging	0.46
R8110:Hectd4	UTSW	5	121332949	missense	possibly damaging	0.96
R8118:Hectd4	UTSW	5	121286376	missense	probably benign	0.33
R8171:Hectd4	UTSW	5	121318756	missense	possibly damaging	0.82
R8234:Hectd4	UTSW	5	121339544	missense	possibly damaging	0.72
R8289:Hectd4	UTSW	5	121266361	missense	possibly damaging	0.53
R8292:Hectd4	UTSW	5	121317225	missense	possibly damaging	0.66
R8348:Hectd4	UTSW	5	121220256	start gained	probably benign
R8397:Hectd4	UTSW	5	121259894	missense	probably damaging	0.98
R8436:Hectd4	UTSW	5	121308358	missense	possibly damaging	0.90
R8436:Hectd4	UTSW	5	121343147	missense	probably benign	0.00
R8443:Hectd4	UTSW	5	121329109	missense	possibly damaging	0.72
R8448:Hectd4	UTSW	5	121220256	start gained	probably benign
R8516:Hectd4	UTSW	5	121349010	missense	possibly damaging	0.53
R8519:Hectd4	UTSW	5	121304426	nonsense	probably null
R8553:Hectd4	UTSW	5	121353598	missense	possibly damaging	0.73
R8557:Hectd4	UTSW	5	121310651	missense	possibly damaging	0.66
R8725:Hectd4	UTSW	5	121350494	missense	probably damaging	1.00
R8751:Hectd4	UTSW	5	121363775	nonsense	probably null
R8769:Hectd4	UTSW	5	121281873	missense	possibly damaging	0.53
R8803:Hectd4	UTSW	5	121323931	missense	probably benign	0.01
R8887:Hectd4	UTSW	5	121295478	missense	probably benign	0.44
R8982:Hectd4	UTSW	5	121328242	missense	probably benign	0.02
R8988:Hectd4	UTSW	5	121277756	missense	possibly damaging	0.86
R8991:Hectd4	UTSW	5	121358284	missense	probably benign	0.33
R8994:Hectd4	UTSW	5	121303566	missense	probably benign	0.33
R8995:Hectd4	UTSW	5	121254359	missense	possibly damaging	0.96
R9049:Hectd4	UTSW	5	121313892	missense	possibly damaging	0.92
R9093:Hectd4	UTSW	5	121273614	missense	probably benign	0.14
R9106:Hectd4	UTSW	5	121329556	missense	possibly damaging	0.53
R9137:Hectd4	UTSW	5	121358175	missense	possibly damaging	0.53
R9146:Hectd4	UTSW	5	121349034	missense	probably benign	0.33
R9154:Hectd4	UTSW	5	121253904	missense
R9162:Hectd4	UTSW	5	121306979	missense	possibly damaging	0.66
R9166:Hectd4	UTSW	5	121308627	missense	probably damaging	0.96
R9183:Hectd4	UTSW	5	121299488	missense	possibly damaging	0.51
R9207:Hectd4	UTSW	5	121295433	missense	possibly damaging	0.86
R9291:Hectd4	UTSW	5	121348965	missense	probably benign	0.14
R9300:Hectd4	UTSW	5	121348889	missense	probably benign	0.33
R9314:Hectd4	UTSW	5	121299645	critical splice donor site	probably null
R9381:Hectd4	UTSW	5	121334429	missense	possibly damaging	0.53
R9432:Hectd4	UTSW	5	121322801	missense	probably benign	0.01
R9491:Hectd4	UTSW	5	121314918	missense	probably damaging	0.97
R9532:Hectd4	UTSW	5	121364553	missense	probably benign	0.00
R9557:Hectd4	UTSW	5	121321554	missense	possibly damaging	0.66
R9561:Hectd4	UTSW	5	121334469	missense	possibly damaging	0.53
R9593:Hectd4	UTSW	5	121286781	nonsense	probably null
R9704:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9705:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9712:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9713:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9726:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9732:Hectd4	UTSW	5	121254191	nonsense	probably null
R9750:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
R9752:Hectd4	UTSW	5	121334352	missense	possibly damaging	0.85
R9772:Hectd4	UTSW	5	121310681	missense	probably benign	0.00
X0026:Hectd4	UTSW	5	121349637	missense	probably benign	0.04
X0027:Hectd4	UTSW	5	121321404	missense	probably benign	0.27
Z1088:Hectd4	UTSW	5	121295503	splice site	probably null
Z1177:Hectd4	UTSW	5	121358320	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAAGGACTCTCCCTGTCATGCCTC -3'
(R):5'- TGGCTCTATCAGGATGCTGCCTAC -3'

Sequencing Primer
(F):5'- ATGTGGCTCTCGTGCAATAC -3'
(R):5'- TCTCCTTCAAGTGCAGATCAGAG -3'

Posted On

2014-05-23