Incidental Mutation 'R1768:Tubgcp3'
ID194591
Institutional Source Beutler Lab
Gene Symbol Tubgcp3
Ensembl Gene ENSMUSG00000000759
Gene Nametubulin, gamma complex associated protein 3
SynonymsSpc98p, GCP3
MMRRC Submission 039799-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R1768 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location12614277-12672248 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 12649686 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000000776] [ENSMUST00000164774]
Predicted Effect probably benign
Transcript: ENSMUST00000000776
SMART Domains Protein: ENSMUSP00000000776
Gene: ENSMUSG00000000759

DomainStartEndE-ValueType
low complexity region 152 171 N/A INTRINSIC
Pfam:Spc97_Spc98 251 761 9.5e-124 PFAM
coiled coil region 787 814 N/A INTRINSIC
low complexity region 821 827 N/A INTRINSIC
low complexity region 890 903 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164774
SMART Domains Protein: ENSMUSP00000127741
Gene: ENSMUSG00000000759

DomainStartEndE-ValueType
low complexity region 152 171 N/A INTRINSIC
Pfam:Spc97_Spc98 251 361 3.5e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164861
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164971
Predicted Effect probably benign
Transcript: ENSMUST00000165321
SMART Domains Protein: ENSMUSP00000131051
Gene: ENSMUSG00000000759

DomainStartEndE-ValueType
low complexity region 35 54 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167547
Predicted Effect probably benign
Transcript: ENSMUST00000172056
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 91% (107/117)
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,623,470 R60P possibly damaging Het
Aox2 T A 1: 58,354,195 C1199S probably benign Het
Arhgap18 G A 10: 26,887,861 M482I probably damaging Het
Arhgap18 G T 10: 26,887,862 A483S probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
BC051019 T C 7: 109,723,174 T38A probably benign Het
Bcam T C 7: 19,765,618 N192S probably null Het
Bend5 A T 4: 111,454,241 K351* probably null Het
Bicdl2 T A 17: 23,665,949 M208K probably damaging Het
Ccdc155 T A 7: 45,188,803 probably null Het
Ccp110 A T 7: 118,726,024 probably null Het
Cdc6 A T 11: 98,912,217 T328S probably damaging Het
Cdk5rap2 G T 4: 70,307,233 N558K probably benign Het
Cdkn1c C T 7: 143,459,121 R146K probably benign Het
Ceacam18 G A 7: 43,648,494 C371Y probably benign Het
Cep95 T A 11: 106,806,351 C233* probably null Het
Chrnd A G 1: 87,194,928 I144V probably benign Het
Col6a4 T A 9: 106,080,100 Q175L probably benign Het
Cym A T 3: 107,213,500 V263E probably damaging Het
Cyp2a4 G T 7: 26,312,772 V327F possibly damaging Het
Dhx29 T A 13: 112,948,240 M664K probably damaging Het
Dlec1 T G 9: 119,146,007 probably null Het
Dna2 T C 10: 62,957,084 Y293H probably benign Het
Dnase1l3 T A 14: 7,974,104 N196Y probably damaging Het
Eea1 T A 10: 95,996,960 D222E probably damaging Het
Efcab14 A T 4: 115,752,919 probably null Het
Entpd5 C T 12: 84,386,211 R189H probably benign Het
Exoc4 A T 6: 33,758,050 K534M probably damaging Het
Extl1 T A 4: 134,371,138 Y194F probably benign Het
Eya1 A G 1: 14,253,075 L161S possibly damaging Het
Fam163b T C 2: 27,112,862 E41G possibly damaging Het
Fam180a A C 6: 35,315,352 S40A probably benign Het
Fbxl4 T C 4: 22,385,950 S186P probably benign Het
Fbxw19 A T 9: 109,494,772 L45* probably null Het
Fgf14 G T 14: 124,676,512 T69N probably benign Het
Flt1 A G 5: 147,672,709 Y432H probably damaging Het
Frmd4b A T 6: 97,306,764 L374Q possibly damaging Het
G6pc2 T A 2: 69,222,977 V125D probably damaging Het
Gna15 A T 10: 81,512,120 L164Q probably damaging Het
Gnaz C A 10: 74,991,870 D151E possibly damaging Het
Has1 T C 17: 17,850,300 T120A probably benign Het
Hectd4 T A 5: 121,358,303 D3919E possibly damaging Het
Hs3st5 A G 10: 36,833,169 I233M probably benign Het
Ilf3 T C 9: 21,403,142 probably benign Het
Inpp5b T A 4: 124,793,276 L765* probably null Het
Insr A T 8: 3,159,561 I1174N probably damaging Het
Kcnq3 A G 15: 66,005,906 L445P probably damaging Het
Kctd20 A T 17: 28,962,850 N159Y probably damaging Het
Kctd20 A T 17: 28,966,781 D366V probably damaging Het
Klk15 T C 7: 43,938,333 probably benign Het
Lama4 T G 10: 39,103,501 N1658K possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mas1 T C 17: 12,841,699 Y279C probably damaging Het
Mast2 G T 4: 116,306,959 D1747E probably damaging Het
Mest G A 6: 30,745,139 M235I probably benign Het
Mfsd6 A G 1: 52,660,805 probably null Het
Mllt10 T A 2: 18,162,846 S449R probably damaging Het
Mon2 T A 10: 123,013,763 T1211S probably benign Het
Mrnip G A 11: 50,176,861 C27Y probably damaging Het
Myh15 A T 16: 49,163,135 T1538S probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Npy1r A G 8: 66,704,525 D199G possibly damaging Het
Numbl A G 7: 27,280,954 T454A probably benign Het
Nutm2 T G 13: 50,473,116 F436V probably damaging Het
Olfr1112 T A 2: 87,191,698 S4T probably benign Het
Olfr330 A G 11: 58,529,776 L70P probably damaging Het
Olfr458 A G 6: 42,460,677 L114S probably damaging Het
Olfr556 A G 7: 102,670,301 Y127C probably damaging Het
Olfr631 C T 7: 103,929,725 R301* probably null Het
Olfr64 A G 7: 103,893,277 S153P probably benign Het
Olfr676 A G 7: 105,035,950 S251G probably benign Het
Olfr707 A T 7: 106,891,977 probably null Het
Olfr707 G T 7: 106,891,978 L44M probably damaging Het
Olfr876 T A 9: 37,804,303 Y131N probably damaging Het
Opa1 T C 16: 29,620,810 S773P probably benign Het
Pde8a G C 7: 81,300,723 probably null Het
Pgam1 T C 19: 41,917,705 F232S probably damaging Het
Pgk1 T A X: 106,200,308 V303E possibly damaging Het
Pirb A T 7: 3,717,190 C395S probably damaging Het
Plxnc1 C T 10: 94,844,322 V824I probably benign Het
Ppp6r1 A G 7: 4,633,692 probably null Het
Rapgef4 C A 2: 72,225,787 probably benign Het
Rars T A 11: 35,809,638 T539S probably damaging Het
Rbm44 G T 1: 91,153,957 probably null Het
RP23-114B10.6 T C 8: 69,373,558 I119M unknown Het
Samd4b A G 7: 28,413,892 I216T probably benign Het
Serpine2 A C 1: 79,816,815 F134V probably damaging Het
Shmt1 A G 11: 60,792,964 Y341H probably damaging Het
Slc23a2 C A 2: 132,075,641 V226F probably benign Het
Slc23a4 A G 6: 34,956,961 I69T probably damaging Het
Slc37a1 C A 17: 31,333,678 T319K possibly damaging Het
Slc6a4 A T 11: 77,013,252 T178S probably damaging Het
Smarca4 G A 9: 21,701,183 A1588T possibly damaging Het
Spag17 A T 3: 100,027,352 Y650F possibly damaging Het
Stab2 C T 10: 87,003,008 G65S probably damaging Het
Stambpl1 C G 19: 34,226,721 N70K probably damaging Het
Stip1 C A 19: 7,021,797 C471F probably damaging Het
Taf1 T C X: 101,540,894 S223P probably benign Het
Tchh C A 3: 93,443,575 N107K possibly damaging Het
Tenm3 A C 8: 48,232,104 H2432Q probably damaging Het
Tmem243 A G 5: 9,118,548 N110S probably damaging Het
Toe1 A T 4: 116,804,879 I306F probably benign Het
Trank1 G A 9: 111,392,927 V2911M probably damaging Het
Trpm4 A G 7: 45,308,612 I811T probably damaging Het
Tspear T A 10: 77,875,116 probably null Het
Ttc28 A T 5: 111,277,168 I1589F possibly damaging Het
U2af2 C A 7: 5,067,545 R78S probably benign Het
Wdr17 A T 8: 54,673,654 D388E possibly damaging Het
Wdr3 A T 3: 100,153,870 S261T probably benign Het
Zfp667 A G 7: 6,305,067 N245D possibly damaging Het
Zfp692 A G 11: 58,310,176 probably benign Het
Zfp729a T C 13: 67,619,251 H953R probably benign Het
Other mutations in Tubgcp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Tubgcp3 APN 8 12621809 missense probably benign 0.00
IGL00583:Tubgcp3 APN 8 12621906 nonsense probably null
IGL01289:Tubgcp3 APN 8 12639625 missense probably damaging 1.00
IGL01578:Tubgcp3 APN 8 12661297 splice site probably benign
IGL01716:Tubgcp3 APN 8 12641094 splice site probably benign
IGL01943:Tubgcp3 APN 8 12654301 missense probably damaging 1.00
IGL02020:Tubgcp3 APN 8 12637780 missense possibly damaging 0.46
IGL02345:Tubgcp3 APN 8 12625056 missense probably damaging 1.00
IGL02555:Tubgcp3 APN 8 12639595 missense probably benign 0.36
IGL02644:Tubgcp3 APN 8 12648733 missense probably damaging 1.00
IGL02976:Tubgcp3 APN 8 12632300 missense probably damaging 1.00
IGL03240:Tubgcp3 APN 8 12649797 missense probably benign 0.07
IGL03287:Tubgcp3 APN 8 12639630 missense possibly damaging 0.77
Tinky_winky UTSW 8 12650171 missense probably damaging 1.00
R0145:Tubgcp3 UTSW 8 12657561 missense probably benign 0.01
R0379:Tubgcp3 UTSW 8 12641116 missense probably damaging 0.97
R0558:Tubgcp3 UTSW 8 12653462 missense probably benign 0.00
R1490:Tubgcp3 UTSW 8 12639550 missense probably damaging 1.00
R1709:Tubgcp3 UTSW 8 12639532 nonsense probably null
R1921:Tubgcp3 UTSW 8 12621932 nonsense probably null
R1928:Tubgcp3 UTSW 8 12663988 missense possibly damaging 0.94
R2161:Tubgcp3 UTSW 8 12632292 missense probably benign 0.22
R3120:Tubgcp3 UTSW 8 12657626 missense possibly damaging 0.51
R3434:Tubgcp3 UTSW 8 12658381 splice site probably null
R4011:Tubgcp3 UTSW 8 12639634 nonsense probably null
R4162:Tubgcp3 UTSW 8 12639547 missense possibly damaging 0.46
R4300:Tubgcp3 UTSW 8 12657600 missense probably damaging 0.99
R4350:Tubgcp3 UTSW 8 12641117 missense probably benign 0.19
R4529:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4530:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4531:Tubgcp3 UTSW 8 12663932 missense probably damaging 0.98
R4676:Tubgcp3 UTSW 8 12650171 missense probably damaging 1.00
R4730:Tubgcp3 UTSW 8 12657654 missense probably benign 0.03
R4828:Tubgcp3 UTSW 8 12671987 missense probably benign
R4860:Tubgcp3 UTSW 8 12649722 missense probably benign 0.03
R4860:Tubgcp3 UTSW 8 12649722 missense probably benign 0.03
R5610:Tubgcp3 UTSW 8 12639577 missense probably damaging 1.00
R5625:Tubgcp3 UTSW 8 12624888 missense possibly damaging 0.46
R5650:Tubgcp3 UTSW 8 12648670 missense probably damaging 0.98
R5775:Tubgcp3 UTSW 8 12625056 missense probably damaging 1.00
R6257:Tubgcp3 UTSW 8 12649835 splice site probably null
R6314:Tubgcp3 UTSW 8 12648625 missense probably benign 0.02
R6970:Tubgcp3 UTSW 8 12637000 missense probably damaging 0.98
R7173:Tubgcp3 UTSW 8 12639259 intron probably null
R7408:Tubgcp3 UTSW 8 12661359 nonsense probably null
R7502:Tubgcp3 UTSW 8 12641207 missense probably damaging 0.99
R7701:Tubgcp3 UTSW 8 12655974 missense probably benign
R7739:Tubgcp3 UTSW 8 12657561 missense probably benign 0.01
R8169:Tubgcp3 UTSW 8 12616099 missense probably benign
R8327:Tubgcp3 UTSW 8 12654343 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CAGCTCATCTCAGGCTAATGGCAG -3'
(R):5'- TGCACTCTCAGGTAAGGACTTCCTC -3'

Sequencing Primer
(F):5'- CTAATGGCAGGCTGCCC -3'
(R):5'- GGGTCCTGTCTACCATATGAAG -3'
Posted On2014-05-23