Mutagenetix > Incidental Mutation

Incidental Mutation 'R1768:Tenm3'

194592

Institutional Source

Beutler Lab

Gene Symbol

Tenm3

Ensembl Gene

ENSMUSG00000031561

Gene Name

teneurin transmembrane protein 3

Synonyms

Ten-m3, Odz3, 2610100B16Rik

MMRRC Submission

039799-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.542) question?

Stock #

R1768 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48227682-48843951 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 48232104 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 2432 (H2432Q)

Ref Sequence

ENSEMBL: ENSMUSP00000033965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000033965
AA Change: H2432Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: H2432Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	11	177	6.9e-91	PFAM
Pfam:Ten_N	171	308	1e-72	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2631	2708	1.5e-34	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000190840
AA Change: H2416Q

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: H2416Q

Domain	Start	End	E-Value	Type
Pfam:Ten_N	10	182	7.6e-77	PFAM
Pfam:Ten_N	168	308	6.6e-50	PFAM
transmembrane domain	309	331	N/A	INTRINSIC
EGF	517	545	2.32e-1	SMART
EGF_like	548	576	4.11e1	SMART
EGF	581	610	1.69e1	SMART
EGF	613	642	1.35e-2	SMART
EGF	647	677	6.11e-1	SMART
EGF	680	708	7.95e0	SMART
EGF	711	739	1.28e1	SMART
EGF	751	783	1.64e-1	SMART
PDB:1RWL\|A	1276	1511	9e-6	PDB
low complexity region	2593	2602	N/A	INTRINSIC
Pfam:Tox-GHH	2630	2708	3.2e-35	PFAM

Meta Mutation Damage Score

0.0804

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.3%
20x: 92.4%

Validation Efficiency

91% (107/117)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 112 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921524L21Rik	G	C	18: 6,623,470	R60P	possibly damaging	Het
Aox2	T	A	1: 58,354,195	C1199S	probably benign	Het
Arhgap18	G	A	10: 26,887,861	M482I	probably damaging	Het
Arhgap18	G	T	10: 26,887,862	A483S	probably damaging	Het
Arid4a	G	A	12: 71,075,338	S509N	probably benign	Het
BC051019	T	C	7: 109,723,174	T38A	probably benign	Het
Bcam	T	C	7: 19,765,618	N192S	probably null	Het
Bend5	A	T	4: 111,454,241	K351*	probably null	Het
Bicdl2	T	A	17: 23,665,949	M208K	probably damaging	Het
Ccdc155	T	A	7: 45,188,803		probably null	Het
Ccp110	A	T	7: 118,726,024		probably null	Het
Cdc6	A	T	11: 98,912,217	T328S	probably damaging	Het
Cdk5rap2	G	T	4: 70,307,233	N558K	probably benign	Het
Cdkn1c	C	T	7: 143,459,121	R146K	probably benign	Het
Ceacam18	G	A	7: 43,648,494	C371Y	probably benign	Het
Cep95	T	A	11: 106,806,351	C233*	probably null	Het
Chrnd	A	G	1: 87,194,928	I144V	probably benign	Het
Col6a4	T	A	9: 106,080,100	Q175L	probably benign	Het
Cym	A	T	3: 107,213,500	V263E	probably damaging	Het
Cyp2a4	G	T	7: 26,312,772	V327F	possibly damaging	Het
Dhx29	T	A	13: 112,948,240	M664K	probably damaging	Het
Dlec1	T	G	9: 119,146,007		probably null	Het
Dna2	T	C	10: 62,957,084	Y293H	probably benign	Het
Dnase1l3	T	A	14: 7,974,104	N196Y	probably damaging	Het
Eea1	T	A	10: 95,996,960	D222E	probably damaging	Het
Efcab14	A	T	4: 115,752,919		probably null	Het
Entpd5	C	T	12: 84,386,211	R189H	probably benign	Het
Exoc4	A	T	6: 33,758,050	K534M	probably damaging	Het
Extl1	T	A	4: 134,371,138	Y194F	probably benign	Het
Eya1	A	G	1: 14,253,075	L161S	possibly damaging	Het
Fam163b	T	C	2: 27,112,862	E41G	possibly damaging	Het
Fam180a	A	C	6: 35,315,352	S40A	probably benign	Het
Fbxl4	T	C	4: 22,385,950	S186P	probably benign	Het
Fbxw19	A	T	9: 109,494,772	L45*	probably null	Het
Fgf14	G	T	14: 124,676,512	T69N	probably benign	Het
Flt1	A	G	5: 147,672,709	Y432H	probably damaging	Het
Frmd4b	A	T	6: 97,306,764	L374Q	possibly damaging	Het
G6pc2	T	A	2: 69,222,977	V125D	probably damaging	Het
Gna15	A	T	10: 81,512,120	L164Q	probably damaging	Het
Gnaz	C	A	10: 74,991,870	D151E	possibly damaging	Het
Has1	T	C	17: 17,850,300	T120A	probably benign	Het
Hectd4	T	A	5: 121,358,303	D3919E	possibly damaging	Het
Hs3st5	A	G	10: 36,833,169	I233M	probably benign	Het
Ilf3	T	C	9: 21,403,142		probably benign	Het
Inpp5b	T	A	4: 124,793,276	L765*	probably null	Het
Insr	A	T	8: 3,159,561	I1174N	probably damaging	Het
Kcnq3	A	G	15: 66,005,906	L445P	probably damaging	Het
Kctd20	A	T	17: 28,962,850	N159Y	probably damaging	Het
Kctd20	A	T	17: 28,966,781	D366V	probably damaging	Het
Klk15	T	C	7: 43,938,333		probably benign	Het
Lama4	T	G	10: 39,103,501	N1658K	possibly damaging	Het
Lonrf2	G	A	1: 38,813,276	P165S	probably benign	Het
Mas1	T	C	17: 12,841,699	Y279C	probably damaging	Het
Mast2	G	T	4: 116,306,959	D1747E	probably damaging	Het
Mest	G	A	6: 30,745,139	M235I	probably benign	Het
Mfsd6	A	G	1: 52,660,805		probably null	Het
Mllt10	T	A	2: 18,162,846	S449R	probably damaging	Het
Mon2	T	A	10: 123,013,763	T1211S	probably benign	Het
Mrnip	G	A	11: 50,176,861	C27Y	probably damaging	Het
Myh15	A	T	16: 49,163,135	T1538S	probably benign	Het
Nfatc2ip	A	G	7: 126,390,462	V250A	probably benign	Het
Npy1r	A	G	8: 66,704,525	D199G	possibly damaging	Het
Numbl	A	G	7: 27,280,954	T454A	probably benign	Het
Nutm2	T	G	13: 50,473,116	F436V	probably damaging	Het
Olfr1112	T	A	2: 87,191,698	S4T	probably benign	Het
Olfr330	A	G	11: 58,529,776	L70P	probably damaging	Het
Olfr458	A	G	6: 42,460,677	L114S	probably damaging	Het
Olfr556	A	G	7: 102,670,301	Y127C	probably damaging	Het
Olfr631	C	T	7: 103,929,725	R301*	probably null	Het
Olfr64	A	G	7: 103,893,277	S153P	probably benign	Het
Olfr676	A	G	7: 105,035,950	S251G	probably benign	Het
Olfr707	A	T	7: 106,891,977		probably null	Het
Olfr707	G	T	7: 106,891,978	L44M	probably damaging	Het
Olfr876	T	A	9: 37,804,303	Y131N	probably damaging	Het
Opa1	T	C	16: 29,620,810	S773P	probably benign	Het
Pde8a	G	C	7: 81,300,723		probably null	Het
Pgam1	T	C	19: 41,917,705	F232S	probably damaging	Het
Pgk1	T	A	X: 106,200,308	V303E	possibly damaging	Het
Pirb	A	T	7: 3,717,190	C395S	probably damaging	Het
Plxnc1	C	T	10: 94,844,322	V824I	probably benign	Het
Ppp6r1	A	G	7: 4,633,692		probably null	Het
Rapgef4	C	A	2: 72,225,787		probably benign	Het
Rars	T	A	11: 35,809,638	T539S	probably damaging	Het
Rbm44	G	T	1: 91,153,957		probably null	Het
RP23-114B10.6	T	C	8: 69,373,558	I119M	unknown	Het
Samd4b	A	G	7: 28,413,892	I216T	probably benign	Het
Serpine2	A	C	1: 79,816,815	F134V	probably damaging	Het
Shmt1	A	G	11: 60,792,964	Y341H	probably damaging	Het
Slc23a2	C	A	2: 132,075,641	V226F	probably benign	Het
Slc23a4	A	G	6: 34,956,961	I69T	probably damaging	Het
Slc37a1	C	A	17: 31,333,678	T319K	possibly damaging	Het
Slc6a4	A	T	11: 77,013,252	T178S	probably damaging	Het
Smarca4	G	A	9: 21,701,183	A1588T	possibly damaging	Het
Spag17	A	T	3: 100,027,352	Y650F	possibly damaging	Het
Stab2	C	T	10: 87,003,008	G65S	probably damaging	Het
Stambpl1	C	G	19: 34,226,721	N70K	probably damaging	Het
Stip1	C	A	19: 7,021,797	C471F	probably damaging	Het
Taf1	T	C	X: 101,540,894	S223P	probably benign	Het
Tchh	C	A	3: 93,443,575	N107K	possibly damaging	Het
Tmem243	A	G	5: 9,118,548	N110S	probably damaging	Het
Toe1	A	T	4: 116,804,879	I306F	probably benign	Het
Trank1	G	A	9: 111,392,927	V2911M	probably damaging	Het
Trpm4	A	G	7: 45,308,612	I811T	probably damaging	Het
Tspear	T	A	10: 77,875,116		probably null	Het
Ttc28	A	T	5: 111,277,168	I1589F	possibly damaging	Het
Tubgcp3	A	G	8: 12,649,686		probably benign	Het
U2af2	C	A	7: 5,067,545	R78S	probably benign	Het
Wdr17	A	T	8: 54,673,654	D388E	possibly damaging	Het
Wdr3	A	T	3: 100,153,870	S261T	probably benign	Het
Zfp667	A	G	7: 6,305,067	N245D	possibly damaging	Het
Zfp692	A	G	11: 58,310,176		probably benign	Het
Zfp729a	T	C	13: 67,619,251	H953R	probably benign	Het

Other mutations in Tenm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Tenm3	APN	8	48417060	missense	probably damaging	1.00
IGL00538:Tenm3	APN	8	48236025	missense	probably damaging	1.00
IGL00719:Tenm3	APN	8	48279042	missense	probably benign	0.39
IGL00720:Tenm3	APN	8	48276421	missense	probably damaging	0.98
IGL00870:Tenm3	APN	8	48417132	missense	probably benign	0.00
IGL00976:Tenm3	APN	8	48256841	missense	probably benign	0.14
IGL01469:Tenm3	APN	8	48236423	missense	probably damaging	1.00
IGL01508:Tenm3	APN	8	48276645	missense	probably benign	0.09
IGL01590:Tenm3	APN	8	48228802	missense	probably damaging	1.00
IGL01610:Tenm3	APN	8	48254477	missense	probably damaging	1.00
IGL01874:Tenm3	APN	8	48236758	nonsense	probably null
IGL01892:Tenm3	APN	8	48276396	missense	probably benign	0.09
IGL02098:Tenm3	APN	8	48276576	missense	possibly damaging	0.94
IGL02382:Tenm3	APN	8	48235476	missense	probably damaging	1.00
IGL02397:Tenm3	APN	8	48236694	missense	possibly damaging	0.94
IGL02475:Tenm3	APN	8	48279198	splice site	probably benign
IGL02502:Tenm3	APN	8	48288016	missense	probably damaging	1.00
IGL02508:Tenm3	APN	8	48299639	missense	probably benign	0.30
IGL02543:Tenm3	APN	8	48298956	missense	probably damaging	1.00
IGL02723:Tenm3	APN	8	48276903	missense	probably benign	0.02
IGL03037:Tenm3	APN	8	48298878	missense	possibly damaging	0.90
IGL03160:Tenm3	APN	8	48646418	missense	probably benign	0.05
IGL03268:Tenm3	APN	8	48235523	missense	probably damaging	1.00
IGL02988:Tenm3	UTSW	8	48235346	missense	probably damaging	0.99
PIT4431001:Tenm3	UTSW	8	48235607	missense	probably damaging	1.00
PIT4504001:Tenm3	UTSW	8	48293657	missense	probably damaging	1.00
R0079:Tenm3	UTSW	8	48343345	missense	possibly damaging	0.90
R0121:Tenm3	UTSW	8	48342659	missense	probably damaging	0.99
R0123:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0134:Tenm3	UTSW	8	48674472	missense	probably damaging	1.00
R0147:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0148:Tenm3	UTSW	8	48236720	missense	probably damaging	1.00
R0309:Tenm3	UTSW	8	48341034	missense	probably damaging	1.00
R0322:Tenm3	UTSW	8	48236912	splice site	probably benign
R0335:Tenm3	UTSW	8	48232105	missense	probably damaging	1.00
R0355:Tenm3	UTSW	8	48228975	missense	probably damaging	1.00
R0411:Tenm3	UTSW	8	48287791	missense	possibly damaging	0.61
R0505:Tenm3	UTSW	8	48341160	splice site	probably benign
R0573:Tenm3	UTSW	8	48674399	splice site	probably benign
R0599:Tenm3	UTSW	8	48277710	missense	probably damaging	1.00
R0616:Tenm3	UTSW	8	48276156	missense	possibly damaging	0.76
R0637:Tenm3	UTSW	8	48236525	missense	probably damaging	1.00
R0726:Tenm3	UTSW	8	48236594	missense	probably damaging	1.00
R0840:Tenm3	UTSW	8	48335742	missense	probably damaging	0.99
R0981:Tenm3	UTSW	8	48298965	missense	probably damaging	1.00
R1006:Tenm3	UTSW	8	48228542	missense	probably damaging	1.00
R1199:Tenm3	UTSW	8	48235582	missense	probably damaging	0.99
R1223:Tenm3	UTSW	8	48240396	missense	possibly damaging	0.72
R1240:Tenm3	UTSW	8	48287893	missense	possibly damaging	0.74
R1394:Tenm3	UTSW	8	48276400	missense	probably benign
R1455:Tenm3	UTSW	8	48279048	missense	possibly damaging	0.87
R1459:Tenm3	UTSW	8	48235971	missense	probably damaging	1.00
R1473:Tenm3	UTSW	8	48310625	missense	probably damaging	1.00
R1501:Tenm3	UTSW	8	48343316	missense	probably damaging	0.99
R1507:Tenm3	UTSW	8	48287822	missense	probably benign	0.01
R1522:Tenm3	UTSW	8	48395576	missense	probably damaging	1.00
R1524:Tenm3	UTSW	8	48228981	missense	possibly damaging	0.92
R1553:Tenm3	UTSW	8	48236421	missense	probably damaging	1.00
R1572:Tenm3	UTSW	8	48228993	missense	possibly damaging	0.94
R1583:Tenm3	UTSW	8	48279074	missense	probably benign	0.09
R1676:Tenm3	UTSW	8	48417119	missense	possibly damaging	0.83
R1732:Tenm3	UTSW	8	48310634	missense	probably damaging	1.00
R1777:Tenm3	UTSW	8	48417179	missense	probably benign	0.05
R1793:Tenm3	UTSW	8	48674544	missense	probably damaging	0.98
R1801:Tenm3	UTSW	8	48276256	missense	probably benign	0.39
R1863:Tenm3	UTSW	8	48276346	missense	probably benign	0.20
R1898:Tenm3	UTSW	8	48310761	missense	probably damaging	1.00
R1971:Tenm3	UTSW	8	48236313	missense	probably damaging	1.00
R1972:Tenm3	UTSW	8	48228591	missense	probably damaging	1.00
R1996:Tenm3	UTSW	8	48228668	missense	probably damaging	1.00
R2061:Tenm3	UTSW	8	48342256	critical splice donor site	probably null
R2109:Tenm3	UTSW	8	48343349	missense	possibly damaging	0.94
R2124:Tenm3	UTSW	8	48417006	critical splice donor site	probably null
R2190:Tenm3	UTSW	8	48395544	missense	probably damaging	1.00
R2204:Tenm3	UTSW	8	48674550	missense	probably benign	0.17
R2233:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2234:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2235:Tenm3	UTSW	8	48276169	missense	probably benign	0.04
R2237:Tenm3	UTSW	8	48342337	missense	probably damaging	1.00
R2418:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2419:Tenm3	UTSW	8	48276658	missense	possibly damaging	0.87
R2435:Tenm3	UTSW	8	48287953	missense	probably damaging	1.00
R2483:Tenm3	UTSW	8	48240270	missense	probably damaging	0.99
R3406:Tenm3	UTSW	8	48228555	missense	probably damaging	1.00
R3724:Tenm3	UTSW	8	48277746	missense	probably damaging	0.97
R4009:Tenm3	UTSW	8	48349223	missense	probably damaging	1.00
R4210:Tenm3	UTSW	8	48349404	missense	probably damaging	1.00
R4293:Tenm3	UTSW	8	48395658	missense	probably damaging	1.00
R4656:Tenm3	UTSW	8	48293726	missense	probably damaging	1.00
R4663:Tenm3	UTSW	8	48235970	missense	probably damaging	1.00
R4835:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R4851:Tenm3	UTSW	8	48310621	critical splice donor site	probably null
R4867:Tenm3	UTSW	8	48235821	missense	probably damaging	1.00
R4892:Tenm3	UTSW	8	48276861	missense	probably damaging	0.99
R4895:Tenm3	UTSW	8	48300971	missense	probably damaging	1.00
R4962:Tenm3	UTSW	8	48278961	nonsense	probably null
R4995:Tenm3	UTSW	8	48229137	missense	possibly damaging	0.87
R4996:Tenm3	UTSW	8	48235826	missense	probably damaging	0.97
R5091:Tenm3	UTSW	8	48342308	missense	probably benign	0.14
R5228:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5253:Tenm3	UTSW	8	48229198	missense	possibly damaging	0.92
R5260:Tenm3	UTSW	8	48236855	missense	probably damaging	1.00
R5363:Tenm3	UTSW	8	48287831	missense	possibly damaging	0.55
R5414:Tenm3	UTSW	8	48236355	missense	probably damaging	1.00
R5427:Tenm3	UTSW	8	48236564	missense	probably damaging	1.00
R5431:Tenm3	UTSW	8	48367377	nonsense	probably null
R5566:Tenm3	UTSW	8	48279006	missense	probably damaging	1.00
R5579:Tenm3	UTSW	8	48236764	missense	probably damaging	1.00
R5656:Tenm3	UTSW	8	48228762	missense	probably damaging	1.00
R5931:Tenm3	UTSW	8	48646498	missense	probably benign	0.00
R5959:Tenm3	UTSW	8	48646447	nonsense	probably null
R5965:Tenm3	UTSW	8	48228508	nonsense	probably null
R6062:Tenm3	UTSW	8	48343406	missense	possibly damaging	0.46
R6151:Tenm3	UTSW	8	48395573	missense	probably damaging	1.00
R6157:Tenm3	UTSW	8	48298808	missense	probably damaging	0.96
R6167:Tenm3	UTSW	8	48254622	missense	possibly damaging	0.46
R6217:Tenm3	UTSW	8	48293665	missense	probably damaging	0.99
R6233:Tenm3	UTSW	8	48417059	missense	probably damaging	1.00
R6270:Tenm3	UTSW	8	48367394	missense	probably damaging	0.98
R6329:Tenm3	UTSW	8	48276849	missense	probably damaging	0.99
R6466:Tenm3	UTSW	8	48236063	missense	probably damaging	0.97
R6515:Tenm3	UTSW	8	48417222	missense	probably benign
R6516:Tenm3	UTSW	8	48417222	missense	probably benign
R6747:Tenm3	UTSW	8	48343243	missense	probably damaging	1.00
R6782:Tenm3	UTSW	8	48646256	critical splice donor site	probably null
R6788:Tenm3	UTSW	8	48674493	missense	probably damaging	1.00
R6823:Tenm3	UTSW	8	48256837	missense	probably damaging	0.99
R6846:Tenm3	UTSW	8	48276738	missense	probably benign	0.39
R6913:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R6941:Tenm3	UTSW	8	48674416	missense	probably damaging	0.99
R6950:Tenm3	UTSW	8	48240479	nonsense	probably null
R6968:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6970:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R6993:Tenm3	UTSW	8	48236439	missense	probably damaging	1.00
R7003:Tenm3	UTSW	8	48240444	missense	probably damaging	1.00
R7125:Tenm3	UTSW	8	48674553	missense	probably benign	0.00
R7140:Tenm3	UTSW	8	48292236	missense	probably damaging	1.00
R7222:Tenm3	UTSW	8	48300969	missense	probably damaging	1.00
R7232:Tenm3	UTSW	8	48235935	missense	probably damaging	1.00
R7336:Tenm3	UTSW	8	48236177	missense	possibly damaging	0.93
R7417:Tenm3	UTSW	8	48236183	missense	probably damaging	1.00
R7526:Tenm3	UTSW	8	48287812	missense	probably damaging	0.96
R7527:Tenm3	UTSW	8	48276600	missense	possibly damaging	0.60
R7616:Tenm3	UTSW	8	48341049	missense	possibly damaging	0.56
R7662:Tenm3	UTSW	8	48335727	missense	probably benign	0.27
R7734:Tenm3	UTSW	8	48646333	missense	probably damaging	1.00
R7802:Tenm3	UTSW	8	48236465	missense	probably damaging	1.00
R7812:Tenm3	UTSW	8	48276300	missense	probably benign	0.01
R7843:Tenm3	UTSW	8	48229111	nonsense	probably null
R7951:Tenm3	UTSW	8	48310703	missense	possibly damaging	0.86
R8293:Tenm3	UTSW	8	48367422	missense	possibly damaging	0.91
R8336:Tenm3	UTSW	8	48293773	missense	probably damaging	1.00
R8351:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8387:Tenm3	UTSW	8	48287848	missense	probably damaging	0.98
R8414:Tenm3	UTSW	8	48293509	missense	probably damaging	1.00
R8451:Tenm3	UTSW	8	48287872	missense	probably damaging	0.96
R8465:Tenm3	UTSW	8	48229181	missense	probably damaging	1.00
R8528:Tenm3	UTSW	8	48342633	missense	probably damaging	1.00
R8717:Tenm3	UTSW	8	48299645	missense	possibly damaging	0.77
R8734:Tenm3	UTSW	8	48349356	missense	probably benign	0.16
R8781:Tenm3	UTSW	8	48342449	frame shift	probably null
R8820:Tenm3	UTSW	8	48310724	missense	probably damaging	0.96
R8821:Tenm3	UTSW	8	48276382	missense
R8831:Tenm3	UTSW	8	48276382	missense
R8853:Tenm3	UTSW	8	48342347	missense	probably damaging	1.00
R8900:Tenm3	UTSW	8	48236402	missense	probably damaging	1.00
R8931:Tenm3	UTSW	8	48235602	missense	probably damaging	1.00
R8933:Tenm3	UTSW	8	48279060	missense	possibly damaging	0.53
R8989:Tenm3	UTSW	8	48235348	nonsense	probably null
R8998:Tenm3	UTSW	8	48276687	missense	probably damaging	1.00
R9008:Tenm3	UTSW	8	48342653	missense	probably damaging	0.98
R9017:Tenm3	UTSW	8	48254633	missense	probably damaging	0.99
R9101:Tenm3	UTSW	8	48292151	missense	probably damaging	1.00
R9108:Tenm3	UTSW	8	48313236	critical splice donor site	probably null
R9142:Tenm3	UTSW	8	48335513	missense	unknown
R9231:Tenm3	UTSW	8	48236196	missense	probably damaging	1.00
R9309:Tenm3	UTSW	8	48298937	missense	probably damaging	0.99
R9310:Tenm3	UTSW	8	48555900	unclassified	probably benign
R9336:Tenm3	UTSW	8	48417080	missense	probably damaging	1.00
R9373:Tenm3	UTSW	8	48299655	missense	probably damaging	1.00
R9393:Tenm3	UTSW	8	48674524	missense	probably damaging	0.99
R9509:Tenm3	UTSW	8	48313257	nonsense	probably null
R9575:Tenm3	UTSW	8	48235761	missense	possibly damaging	0.94
R9698:Tenm3	UTSW	8	48236211	missense	probably damaging	1.00
R9722:Tenm3	UTSW	8	48300814	missense	probably benign	0.00
R9788:Tenm3	UTSW	8	48335561	missense	probably benign	0.02
X0010:Tenm3	UTSW	8	48287829	missense	probably damaging	0.98
X0025:Tenm3	UTSW	8	48236477	missense	probably damaging	1.00
Z1177:Tenm3	UTSW	8	48276780	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTGGGCTGCTAATTTGAAATCCG -3'
(R):5'- GCATTTGCCATAGTCCTGCTGTTG -3'

Sequencing Primer
(F):5'- gaaaaagaaaaagaaaaaaaaCCGGG -3'
(R):5'- CTGCATGTCTAAAAATAGACAGTGG -3'

Posted On

2014-05-23