Incidental Mutation 'R1768:Tenm3'
ID 194592
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Name teneurin transmembrane protein 3
Synonyms Odz3, Ten-m3, 2610100B16Rik
MMRRC Submission 039799-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.472) question?
Stock # R1768 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 48680717-49296986 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 48685139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 2432 (H2432Q)
Ref Sequence ENSEMBL: ENSMUSP00000033965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000033965
AA Change: H2432Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: H2432Q

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190840
AA Change: H2416Q

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: H2416Q

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Meta Mutation Damage Score 0.0804 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 91% (107/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,623,470 (GRCm39) R60P possibly damaging Het
Aox1 T A 1: 58,393,354 (GRCm39) C1199S probably benign Het
Arhgap18 G A 10: 26,763,857 (GRCm39) M482I probably damaging Het
Arhgap18 G T 10: 26,763,858 (GRCm39) A483S probably damaging Het
Arid4a G A 12: 71,122,112 (GRCm39) S509N probably benign Het
BC051019 T C 7: 109,322,381 (GRCm39) T38A probably benign Het
Bcam T C 7: 19,499,543 (GRCm39) N192S probably null Het
Bend5 A T 4: 111,311,438 (GRCm39) K351* probably null Het
Bicdl2 T A 17: 23,884,923 (GRCm39) M208K probably damaging Het
Ccp110 A T 7: 118,325,247 (GRCm39) probably null Het
Cdc6 A T 11: 98,803,043 (GRCm39) T328S probably damaging Het
Cdk5rap2 G T 4: 70,225,470 (GRCm39) N558K probably benign Het
Cdkn1c C T 7: 143,012,858 (GRCm39) R146K probably benign Het
Ceacam18 G A 7: 43,297,918 (GRCm39) C371Y probably benign Het
Cep95 T A 11: 106,697,177 (GRCm39) C233* probably null Het
Chrnd A G 1: 87,122,650 (GRCm39) I144V probably benign Het
Col6a4 T A 9: 105,957,299 (GRCm39) Q175L probably benign Het
Cym A T 3: 107,120,816 (GRCm39) V263E probably damaging Het
Cyp2a4 G T 7: 26,012,197 (GRCm39) V327F possibly damaging Het
Dhx29 T A 13: 113,084,774 (GRCm39) M664K probably damaging Het
Dlec1 T G 9: 118,975,075 (GRCm39) probably null Het
Dna2 T C 10: 62,792,863 (GRCm39) Y293H probably benign Het
Dnase1l3 T A 14: 7,974,104 (GRCm38) N196Y probably damaging Het
Eea1 T A 10: 95,832,822 (GRCm39) D222E probably damaging Het
Efcab14 A T 4: 115,610,116 (GRCm39) probably null Het
Entpd5 C T 12: 84,432,985 (GRCm39) R189H probably benign Het
Exoc4 A T 6: 33,734,985 (GRCm39) K534M probably damaging Het
Extl1 T A 4: 134,098,449 (GRCm39) Y194F probably benign Het
Eya1 A G 1: 14,323,299 (GRCm39) L161S possibly damaging Het
Fam163b T C 2: 27,002,874 (GRCm39) E41G possibly damaging Het
Fam180a A C 6: 35,292,287 (GRCm39) S40A probably benign Het
Fbxl4 T C 4: 22,385,950 (GRCm39) S186P probably benign Het
Fbxw19 A T 9: 109,323,840 (GRCm39) L45* probably null Het
Fgf14 G T 14: 124,913,924 (GRCm39) T69N probably benign Het
Flt1 A G 5: 147,609,519 (GRCm39) Y432H probably damaging Het
Frmd4b A T 6: 97,283,725 (GRCm39) L374Q possibly damaging Het
G6pc2 T A 2: 69,053,321 (GRCm39) V125D probably damaging Het
Gm10033 T C 8: 69,826,210 (GRCm39) I119M unknown Het
Gna15 A T 10: 81,347,954 (GRCm39) L164Q probably damaging Het
Gnaz C A 10: 74,827,702 (GRCm39) D151E possibly damaging Het
Has1 T C 17: 18,070,562 (GRCm39) T120A probably benign Het
Hectd4 T A 5: 121,496,366 (GRCm39) D3919E possibly damaging Het
Hs3st5 A G 10: 36,709,165 (GRCm39) I233M probably benign Het
Ilf3 T C 9: 21,314,438 (GRCm39) probably benign Het
Inpp5b T A 4: 124,687,069 (GRCm39) L765* probably null Het
Insr A T 8: 3,209,561 (GRCm39) I1174N probably damaging Het
Kash5 T A 7: 44,838,227 (GRCm39) probably null Het
Kcnq3 A G 15: 65,877,755 (GRCm39) L445P probably damaging Het
Kctd20 A T 17: 29,181,824 (GRCm39) N159Y probably damaging Het
Kctd20 A T 17: 29,185,755 (GRCm39) D366V probably damaging Het
Klk15 T C 7: 43,587,757 (GRCm39) probably benign Het
Lama4 T G 10: 38,979,497 (GRCm39) N1658K possibly damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Mas1 T C 17: 13,060,586 (GRCm39) Y279C probably damaging Het
Mast2 G T 4: 116,164,156 (GRCm39) D1747E probably damaging Het
Mest G A 6: 30,745,138 (GRCm39) M235I probably benign Het
Mfsd6 A G 1: 52,699,964 (GRCm39) probably null Het
Mllt10 T A 2: 18,167,657 (GRCm39) S449R probably damaging Het
Mon2 T A 10: 122,849,668 (GRCm39) T1211S probably benign Het
Mrnip G A 11: 50,067,688 (GRCm39) C27Y probably damaging Het
Myh15 A T 16: 48,983,498 (GRCm39) T1538S probably benign Het
Nfatc2ip A G 7: 125,989,634 (GRCm39) V250A probably benign Het
Npy1r A G 8: 67,157,177 (GRCm39) D199G possibly damaging Het
Numbl A G 7: 26,980,379 (GRCm39) T454A probably benign Het
Nutm2 T G 13: 50,627,152 (GRCm39) F436V probably damaging Het
Opa1 T C 16: 29,439,628 (GRCm39) S773P probably benign Het
Or12e1 T A 2: 87,022,042 (GRCm39) S4T probably benign Het
Or2d3 A T 7: 106,491,184 (GRCm39) probably null Het
Or2d3 G T 7: 106,491,185 (GRCm39) L44M probably damaging Het
Or2r11 A G 6: 42,437,611 (GRCm39) L114S probably damaging Het
Or2t48 A G 11: 58,420,602 (GRCm39) L70P probably damaging Het
Or51b17 A G 7: 103,542,484 (GRCm39) S153P probably benign Het
Or51m1 C T 7: 103,578,932 (GRCm39) R301* probably null Het
Or52e7 A G 7: 104,685,157 (GRCm39) S251G probably benign Het
Or52i2 A G 7: 102,319,508 (GRCm39) Y127C probably damaging Het
Or8b12c T A 9: 37,715,599 (GRCm39) Y131N probably damaging Het
Pde8a G C 7: 80,950,471 (GRCm39) probably null Het
Pgam1 T C 19: 41,906,144 (GRCm39) F232S probably damaging Het
Pgk1 T A X: 105,243,914 (GRCm39) V303E possibly damaging Het
Pirb A T 7: 3,720,189 (GRCm39) C395S probably damaging Het
Plxnc1 C T 10: 94,680,184 (GRCm39) V824I probably benign Het
Ppp6r1 A G 7: 4,636,691 (GRCm39) probably null Het
Rapgef4 C A 2: 72,056,131 (GRCm39) probably benign Het
Rars1 T A 11: 35,700,465 (GRCm39) T539S probably damaging Het
Rbm44 G T 1: 91,081,679 (GRCm39) probably null Het
Samd4b A G 7: 28,113,317 (GRCm39) I216T probably benign Het
Serpine2 A C 1: 79,794,532 (GRCm39) F134V probably damaging Het
Shmt1 A G 11: 60,683,790 (GRCm39) Y341H probably damaging Het
Slc23a2 C A 2: 131,917,561 (GRCm39) V226F probably benign Het
Slc23a4 A G 6: 34,933,896 (GRCm39) I69T probably damaging Het
Slc37a1 C A 17: 31,552,652 (GRCm39) T319K possibly damaging Het
Slc6a4 A T 11: 76,904,078 (GRCm39) T178S probably damaging Het
Smarca4 G A 9: 21,612,479 (GRCm39) A1588T possibly damaging Het
Spag17 A T 3: 99,934,668 (GRCm39) Y650F possibly damaging Het
Stab2 C T 10: 86,838,872 (GRCm39) G65S probably damaging Het
Stambpl1 C G 19: 34,204,121 (GRCm39) N70K probably damaging Het
Stip1 C A 19: 6,999,165 (GRCm39) C471F probably damaging Het
Taf1 T C X: 100,584,500 (GRCm39) S223P probably benign Het
Tchh C A 3: 93,350,882 (GRCm39) N107K possibly damaging Het
Tmem243 A G 5: 9,168,548 (GRCm39) N110S probably damaging Het
Toe1 A T 4: 116,662,076 (GRCm39) I306F probably benign Het
Trank1 G A 9: 111,221,995 (GRCm39) V2911M probably damaging Het
Trpm4 A G 7: 44,958,036 (GRCm39) I811T probably damaging Het
Tspear T A 10: 77,710,950 (GRCm39) probably null Het
Ttc28 A T 5: 111,425,034 (GRCm39) I1589F possibly damaging Het
Tubgcp3 A G 8: 12,699,686 (GRCm39) probably benign Het
U2af2 C A 7: 5,070,544 (GRCm39) R78S probably benign Het
Wdr17 A T 8: 55,126,689 (GRCm39) D388E possibly damaging Het
Wdr3 A T 3: 100,061,186 (GRCm39) S261T probably benign Het
Zfp667 A G 7: 6,308,066 (GRCm39) N245D possibly damaging Het
Zfp692 A G 11: 58,201,002 (GRCm39) probably benign Het
Zfp729a T C 13: 67,767,370 (GRCm39) H953R probably benign Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48,870,095 (GRCm39) missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48,689,060 (GRCm39) missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48,732,077 (GRCm39) missense probably benign 0.39
IGL00720:Tenm3 APN 8 48,729,456 (GRCm39) missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48,870,167 (GRCm39) missense probably benign 0.00
IGL00976:Tenm3 APN 8 48,709,876 (GRCm39) missense probably benign 0.14
IGL01469:Tenm3 APN 8 48,689,458 (GRCm39) missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48,729,680 (GRCm39) missense probably benign 0.09
IGL01590:Tenm3 APN 8 48,681,837 (GRCm39) missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48,707,512 (GRCm39) missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48,689,793 (GRCm39) nonsense probably null
IGL01892:Tenm3 APN 8 48,729,431 (GRCm39) missense probably benign 0.09
IGL02098:Tenm3 APN 8 48,729,611 (GRCm39) missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48,688,511 (GRCm39) missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48,689,729 (GRCm39) missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48,732,233 (GRCm39) splice site probably benign
IGL02502:Tenm3 APN 8 48,741,051 (GRCm39) missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48,752,674 (GRCm39) missense probably benign 0.30
IGL02543:Tenm3 APN 8 48,751,991 (GRCm39) missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48,729,938 (GRCm39) missense probably benign 0.02
IGL03037:Tenm3 APN 8 48,751,913 (GRCm39) missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 49,099,453 (GRCm39) missense probably benign 0.05
IGL03268:Tenm3 APN 8 48,688,558 (GRCm39) missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48,688,381 (GRCm39) missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48,688,642 (GRCm39) missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48,746,692 (GRCm39) missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48,796,380 (GRCm39) missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48,795,694 (GRCm39) missense probably damaging 0.99
R0123:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0134:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48,794,069 (GRCm39) missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48,689,947 (GRCm39) splice site probably benign
R0335:Tenm3 UTSW 8 48,685,140 (GRCm39) missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48,682,010 (GRCm39) missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48,740,826 (GRCm39) missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48,794,195 (GRCm39) splice site probably benign
R0573:Tenm3 UTSW 8 49,127,434 (GRCm39) splice site probably benign
R0599:Tenm3 UTSW 8 48,730,745 (GRCm39) missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48,729,191 (GRCm39) missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48,689,560 (GRCm39) missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48,689,629 (GRCm39) missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48,788,777 (GRCm39) missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48,752,000 (GRCm39) missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48,681,577 (GRCm39) missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48,688,617 (GRCm39) missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48,693,431 (GRCm39) missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48,740,928 (GRCm39) missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48,729,435 (GRCm39) missense probably benign
R1455:Tenm3 UTSW 8 48,732,083 (GRCm39) missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48,689,006 (GRCm39) missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48,763,660 (GRCm39) missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48,796,351 (GRCm39) missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48,740,857 (GRCm39) missense probably benign 0.01
R1522:Tenm3 UTSW 8 48,848,611 (GRCm39) missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48,682,016 (GRCm39) missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48,689,456 (GRCm39) missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48,682,028 (GRCm39) missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48,732,109 (GRCm39) missense probably benign 0.09
R1676:Tenm3 UTSW 8 48,870,154 (GRCm39) missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48,763,669 (GRCm39) missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48,870,214 (GRCm39) missense probably benign 0.05
R1793:Tenm3 UTSW 8 49,127,579 (GRCm39) missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48,729,291 (GRCm39) missense probably benign 0.39
R1863:Tenm3 UTSW 8 48,729,381 (GRCm39) missense probably benign 0.20
R1898:Tenm3 UTSW 8 48,763,796 (GRCm39) missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48,689,348 (GRCm39) missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48,681,626 (GRCm39) missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48,681,703 (GRCm39) missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48,795,291 (GRCm39) critical splice donor site probably null
R2109:Tenm3 UTSW 8 48,796,384 (GRCm39) missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48,870,041 (GRCm39) critical splice donor site probably null
R2190:Tenm3 UTSW 8 48,848,579 (GRCm39) missense probably damaging 1.00
R2204:Tenm3 UTSW 8 49,127,585 (GRCm39) missense probably benign 0.17
R2233:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2234:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2235:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2237:Tenm3 UTSW 8 48,795,372 (GRCm39) missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48,740,988 (GRCm39) missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48,693,305 (GRCm39) missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48,681,590 (GRCm39) missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48,730,781 (GRCm39) missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48,802,258 (GRCm39) missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48,802,439 (GRCm39) missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48,848,693 (GRCm39) missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48,746,761 (GRCm39) missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48,689,005 (GRCm39) missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R4851:Tenm3 UTSW 8 48,763,656 (GRCm39) critical splice donor site probably null
R4867:Tenm3 UTSW 8 48,688,856 (GRCm39) missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48,729,896 (GRCm39) missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48,754,006 (GRCm39) missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48,731,996 (GRCm39) nonsense probably null
R4995:Tenm3 UTSW 8 48,682,172 (GRCm39) missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48,688,861 (GRCm39) missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48,795,343 (GRCm39) missense probably benign 0.14
R5228:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48,682,233 (GRCm39) missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48,689,890 (GRCm39) missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48,740,866 (GRCm39) missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48,689,599 (GRCm39) missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48,820,412 (GRCm39) nonsense probably null
R5566:Tenm3 UTSW 8 48,732,041 (GRCm39) missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48,689,799 (GRCm39) missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48,681,797 (GRCm39) missense probably damaging 1.00
R5931:Tenm3 UTSW 8 49,099,533 (GRCm39) missense probably benign 0.00
R5959:Tenm3 UTSW 8 49,099,482 (GRCm39) nonsense probably null
R5965:Tenm3 UTSW 8 48,681,543 (GRCm39) nonsense probably null
R6062:Tenm3 UTSW 8 48,796,441 (GRCm39) missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48,848,608 (GRCm39) missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48,751,843 (GRCm39) missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48,707,657 (GRCm39) missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48,746,700 (GRCm39) missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48,870,094 (GRCm39) missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48,820,429 (GRCm39) missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48,729,884 (GRCm39) missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48,689,098 (GRCm39) missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6516:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6747:Tenm3 UTSW 8 48,796,278 (GRCm39) missense probably damaging 1.00
R6782:Tenm3 UTSW 8 49,099,291 (GRCm39) critical splice donor site probably null
R6788:Tenm3 UTSW 8 49,127,528 (GRCm39) missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48,709,872 (GRCm39) missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48,729,773 (GRCm39) missense probably benign 0.39
R6913:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R6941:Tenm3 UTSW 8 49,127,451 (GRCm39) missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48,693,514 (GRCm39) nonsense probably null
R6968:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48,693,479 (GRCm39) missense probably damaging 1.00
R7125:Tenm3 UTSW 8 49,127,588 (GRCm39) missense probably benign 0.00
R7140:Tenm3 UTSW 8 48,745,271 (GRCm39) missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48,754,004 (GRCm39) missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48,688,970 (GRCm39) missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48,689,212 (GRCm39) missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48,689,218 (GRCm39) missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48,740,847 (GRCm39) missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48,729,635 (GRCm39) missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48,794,084 (GRCm39) missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48,788,762 (GRCm39) missense probably benign 0.27
R7734:Tenm3 UTSW 8 49,099,368 (GRCm39) missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48,689,500 (GRCm39) missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48,729,335 (GRCm39) missense probably benign 0.01
R7843:Tenm3 UTSW 8 48,682,146 (GRCm39) nonsense probably null
R7951:Tenm3 UTSW 8 48,763,738 (GRCm39) missense possibly damaging 0.86
R8293:Tenm3 UTSW 8 48,820,457 (GRCm39) missense possibly damaging 0.91
R8336:Tenm3 UTSW 8 48,746,808 (GRCm39) missense probably damaging 1.00
R8351:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8387:Tenm3 UTSW 8 48,740,883 (GRCm39) missense probably damaging 0.98
R8414:Tenm3 UTSW 8 48,746,544 (GRCm39) missense probably damaging 1.00
R8451:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8465:Tenm3 UTSW 8 48,682,216 (GRCm39) missense probably damaging 1.00
R8528:Tenm3 UTSW 8 48,795,668 (GRCm39) missense probably damaging 1.00
R8717:Tenm3 UTSW 8 48,752,680 (GRCm39) missense possibly damaging 0.77
R8734:Tenm3 UTSW 8 48,802,391 (GRCm39) missense probably benign 0.16
R8781:Tenm3 UTSW 8 48,795,484 (GRCm39) frame shift probably null
R8820:Tenm3 UTSW 8 48,763,759 (GRCm39) missense probably damaging 0.96
R8821:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8831:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8853:Tenm3 UTSW 8 48,795,382 (GRCm39) missense probably damaging 1.00
R8900:Tenm3 UTSW 8 48,689,437 (GRCm39) missense probably damaging 1.00
R8931:Tenm3 UTSW 8 48,688,637 (GRCm39) missense probably damaging 1.00
R8933:Tenm3 UTSW 8 48,732,095 (GRCm39) missense possibly damaging 0.53
R8989:Tenm3 UTSW 8 48,688,383 (GRCm39) nonsense probably null
R8998:Tenm3 UTSW 8 48,729,722 (GRCm39) missense probably damaging 1.00
R9008:Tenm3 UTSW 8 48,795,688 (GRCm39) missense probably damaging 0.98
R9017:Tenm3 UTSW 8 48,707,668 (GRCm39) missense probably damaging 0.99
R9101:Tenm3 UTSW 8 48,745,186 (GRCm39) missense probably damaging 1.00
R9108:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R9142:Tenm3 UTSW 8 48,788,548 (GRCm39) missense unknown
R9231:Tenm3 UTSW 8 48,689,231 (GRCm39) missense probably damaging 1.00
R9309:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R9310:Tenm3 UTSW 8 49,008,935 (GRCm39) unclassified probably benign
R9336:Tenm3 UTSW 8 48,870,115 (GRCm39) missense probably damaging 1.00
R9373:Tenm3 UTSW 8 48,752,690 (GRCm39) missense probably damaging 1.00
R9393:Tenm3 UTSW 8 49,127,559 (GRCm39) missense probably damaging 0.99
R9509:Tenm3 UTSW 8 48,766,292 (GRCm39) nonsense probably null
R9575:Tenm3 UTSW 8 48,688,796 (GRCm39) missense possibly damaging 0.94
R9698:Tenm3 UTSW 8 48,689,246 (GRCm39) missense probably damaging 1.00
R9722:Tenm3 UTSW 8 48,753,849 (GRCm39) missense probably benign 0.00
R9788:Tenm3 UTSW 8 48,788,596 (GRCm39) missense probably benign 0.02
X0010:Tenm3 UTSW 8 48,740,864 (GRCm39) missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48,689,512 (GRCm39) missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48,729,815 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGGGCTGCTAATTTGAAATCCG -3'
(R):5'- GCATTTGCCATAGTCCTGCTGTTG -3'

Sequencing Primer
(F):5'- gaaaaagaaaaagaaaaaaaaCCGGG -3'
(R):5'- CTGCATGTCTAAAAATAGACAGTGG -3'
Posted On 2014-05-23