Incidental Mutation 'R1768:Smarca4'
ID 194597
Institutional Source Beutler Lab
Gene Symbol Smarca4
Ensembl Gene ENSMUSG00000032187
Gene Name SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms SNF2beta, SW1/SNF, b2b508.1Clo, Brg1, b2b692Clo
MMRRC Submission 039799-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1768 (G1)
Quality Score 168
Status Validated
Chromosome 9
Chromosomal Location 21616169-21704230 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 21701183 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 1588 (A1588T)
Ref Sequence ENSEMBL: ENSMUSP00000133922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]
AlphaFold Q3TKT4
Predicted Effect probably benign
Transcript: ENSMUST00000034707
AA Change: A1589T

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187
AA Change: A1589T

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1533 4.19e-42 SMART
low complexity region 1534 1557 N/A INTRINSIC
low complexity region 1578 1588 N/A INTRINSIC
low complexity region 1594 1614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098948
AA Change: A1592T

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187
AA Change: A1592T

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1363 1388 N/A INTRINSIC
low complexity region 1391 1401 N/A INTRINSIC
BROMO 1425 1536 4.19e-42 SMART
low complexity region 1537 1560 N/A INTRINSIC
low complexity region 1581 1591 N/A INTRINSIC
low complexity region 1597 1617 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174008
AA Change: A1588T

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187
AA Change: A1588T

DomainStartEndE-ValueType
low complexity region 6 58 N/A INTRINSIC
low complexity region 130 153 N/A INTRINSIC
QLQ 170 206 3.98e-14 SMART
low complexity region 221 247 N/A INTRINSIC
low complexity region 252 289 N/A INTRINSIC
low complexity region 304 330 N/A INTRINSIC
low complexity region 407 418 N/A INTRINSIC
HSA 460 532 2e-27 SMART
coiled coil region 563 595 N/A INTRINSIC
BRK 612 656 5.17e-21 SMART
low complexity region 657 672 N/A INTRINSIC
low complexity region 691 702 N/A INTRINSIC
DEXDc 750 942 5.17e-38 SMART
Blast:DEXDc 953 985 7e-10 BLAST
low complexity region 1019 1034 N/A INTRINSIC
HELICc 1110 1194 7.27e-24 SMART
low complexity region 1252 1267 N/A INTRINSIC
SnAC 1288 1356 2.8e-29 SMART
low complexity region 1360 1385 N/A INTRINSIC
low complexity region 1388 1398 N/A INTRINSIC
BROMO 1422 1532 1.36e-41 SMART
low complexity region 1533 1556 N/A INTRINSIC
low complexity region 1577 1587 N/A INTRINSIC
low complexity region 1593 1613 N/A INTRINSIC
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 91% (107/117)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 112 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik G C 18: 6,623,470 R60P possibly damaging Het
Aox2 T A 1: 58,354,195 C1199S probably benign Het
Arhgap18 G A 10: 26,887,861 M482I probably damaging Het
Arhgap18 G T 10: 26,887,862 A483S probably damaging Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
BC051019 T C 7: 109,723,174 T38A probably benign Het
Bcam T C 7: 19,765,618 N192S probably null Het
Bend5 A T 4: 111,454,241 K351* probably null Het
Bicdl2 T A 17: 23,665,949 M208K probably damaging Het
Ccdc155 T A 7: 45,188,803 probably null Het
Ccp110 A T 7: 118,726,024 probably null Het
Cdc6 A T 11: 98,912,217 T328S probably damaging Het
Cdk5rap2 G T 4: 70,307,233 N558K probably benign Het
Cdkn1c C T 7: 143,459,121 R146K probably benign Het
Ceacam18 G A 7: 43,648,494 C371Y probably benign Het
Cep95 T A 11: 106,806,351 C233* probably null Het
Chrnd A G 1: 87,194,928 I144V probably benign Het
Col6a4 T A 9: 106,080,100 Q175L probably benign Het
Cym A T 3: 107,213,500 V263E probably damaging Het
Cyp2a4 G T 7: 26,312,772 V327F possibly damaging Het
Dhx29 T A 13: 112,948,240 M664K probably damaging Het
Dlec1 T G 9: 119,146,007 probably null Het
Dna2 T C 10: 62,957,084 Y293H probably benign Het
Dnase1l3 T A 14: 7,974,104 N196Y probably damaging Het
Eea1 T A 10: 95,996,960 D222E probably damaging Het
Efcab14 A T 4: 115,752,919 probably null Het
Entpd5 C T 12: 84,386,211 R189H probably benign Het
Exoc4 A T 6: 33,758,050 K534M probably damaging Het
Extl1 T A 4: 134,371,138 Y194F probably benign Het
Eya1 A G 1: 14,253,075 L161S possibly damaging Het
Fam163b T C 2: 27,112,862 E41G possibly damaging Het
Fam180a A C 6: 35,315,352 S40A probably benign Het
Fbxl4 T C 4: 22,385,950 S186P probably benign Het
Fbxw19 A T 9: 109,494,772 L45* probably null Het
Fgf14 G T 14: 124,676,512 T69N probably benign Het
Flt1 A G 5: 147,672,709 Y432H probably damaging Het
Frmd4b A T 6: 97,306,764 L374Q possibly damaging Het
G6pc2 T A 2: 69,222,977 V125D probably damaging Het
Gna15 A T 10: 81,512,120 L164Q probably damaging Het
Gnaz C A 10: 74,991,870 D151E possibly damaging Het
Has1 T C 17: 17,850,300 T120A probably benign Het
Hectd4 T A 5: 121,358,303 D3919E possibly damaging Het
Hs3st5 A G 10: 36,833,169 I233M probably benign Het
Ilf3 T C 9: 21,403,142 probably benign Het
Inpp5b T A 4: 124,793,276 L765* probably null Het
Insr A T 8: 3,159,561 I1174N probably damaging Het
Kcnq3 A G 15: 66,005,906 L445P probably damaging Het
Kctd20 A T 17: 28,962,850 N159Y probably damaging Het
Kctd20 A T 17: 28,966,781 D366V probably damaging Het
Klk15 T C 7: 43,938,333 probably benign Het
Lama4 T G 10: 39,103,501 N1658K possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Mas1 T C 17: 12,841,699 Y279C probably damaging Het
Mast2 G T 4: 116,306,959 D1747E probably damaging Het
Mest G A 6: 30,745,139 M235I probably benign Het
Mfsd6 A G 1: 52,660,805 probably null Het
Mllt10 T A 2: 18,162,846 S449R probably damaging Het
Mon2 T A 10: 123,013,763 T1211S probably benign Het
Mrnip G A 11: 50,176,861 C27Y probably damaging Het
Myh15 A T 16: 49,163,135 T1538S probably benign Het
Nfatc2ip A G 7: 126,390,462 V250A probably benign Het
Npy1r A G 8: 66,704,525 D199G possibly damaging Het
Numbl A G 7: 27,280,954 T454A probably benign Het
Nutm2 T G 13: 50,473,116 F436V probably damaging Het
Olfr1112 T A 2: 87,191,698 S4T probably benign Het
Olfr330 A G 11: 58,529,776 L70P probably damaging Het
Olfr458 A G 6: 42,460,677 L114S probably damaging Het
Olfr556 A G 7: 102,670,301 Y127C probably damaging Het
Olfr631 C T 7: 103,929,725 R301* probably null Het
Olfr64 A G 7: 103,893,277 S153P probably benign Het
Olfr676 A G 7: 105,035,950 S251G probably benign Het
Olfr707 A T 7: 106,891,977 probably null Het
Olfr707 G T 7: 106,891,978 L44M probably damaging Het
Olfr876 T A 9: 37,804,303 Y131N probably damaging Het
Opa1 T C 16: 29,620,810 S773P probably benign Het
Pde8a G C 7: 81,300,723 probably null Het
Pgam1 T C 19: 41,917,705 F232S probably damaging Het
Pgk1 T A X: 106,200,308 V303E possibly damaging Het
Pirb A T 7: 3,717,190 C395S probably damaging Het
Plxnc1 C T 10: 94,844,322 V824I probably benign Het
Ppp6r1 A G 7: 4,633,692 probably null Het
Rapgef4 C A 2: 72,225,787 probably benign Het
Rars T A 11: 35,809,638 T539S probably damaging Het
Rbm44 G T 1: 91,153,957 probably null Het
RP23-114B10.6 T C 8: 69,373,558 I119M unknown Het
Samd4b A G 7: 28,413,892 I216T probably benign Het
Serpine2 A C 1: 79,816,815 F134V probably damaging Het
Shmt1 A G 11: 60,792,964 Y341H probably damaging Het
Slc23a2 C A 2: 132,075,641 V226F probably benign Het
Slc23a4 A G 6: 34,956,961 I69T probably damaging Het
Slc37a1 C A 17: 31,333,678 T319K possibly damaging Het
Slc6a4 A T 11: 77,013,252 T178S probably damaging Het
Spag17 A T 3: 100,027,352 Y650F possibly damaging Het
Stab2 C T 10: 87,003,008 G65S probably damaging Het
Stambpl1 C G 19: 34,226,721 N70K probably damaging Het
Stip1 C A 19: 7,021,797 C471F probably damaging Het
Taf1 T C X: 101,540,894 S223P probably benign Het
Tchh C A 3: 93,443,575 N107K possibly damaging Het
Tenm3 A C 8: 48,232,104 H2432Q probably damaging Het
Tmem243 A G 5: 9,118,548 N110S probably damaging Het
Toe1 A T 4: 116,804,879 I306F probably benign Het
Trank1 G A 9: 111,392,927 V2911M probably damaging Het
Trpm4 A G 7: 45,308,612 I811T probably damaging Het
Tspear T A 10: 77,875,116 probably null Het
Ttc28 A T 5: 111,277,168 I1589F possibly damaging Het
Tubgcp3 A G 8: 12,649,686 probably benign Het
U2af2 C A 7: 5,067,545 R78S probably benign Het
Wdr17 A T 8: 54,673,654 D388E possibly damaging Het
Wdr3 A T 3: 100,153,870 S261T probably benign Het
Zfp667 A G 7: 6,305,067 N245D possibly damaging Het
Zfp692 A G 11: 58,310,176 probably benign Het
Zfp729a T C 13: 67,619,251 H953R probably benign Het
Other mutations in Smarca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Smarca4 APN 9 21679073 missense probably benign 0.30
IGL01694:Smarca4 APN 9 21665870 missense probably damaging 1.00
IGL02147:Smarca4 APN 9 21635703 missense probably damaging 0.98
IGL02417:Smarca4 APN 9 21701090 missense probably damaging 1.00
IGL02421:Smarca4 APN 9 21639239 missense probably damaging 1.00
IGL02550:Smarca4 APN 9 21686122 missense probably benign 0.25
IGL02794:Smarca4 APN 9 21673342 splice site probably benign
IGL03030:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03037:Smarca4 APN 9 21632935 unclassified probably benign
IGL03069:Smarca4 APN 9 21635836 missense probably benign 0.14
IGL03355:Smarca4 APN 9 21635836 missense probably benign 0.14
R0123:Smarca4 UTSW 9 21637324 missense probably damaging 1.00
R0134:Smarca4 UTSW 9 21637324 missense probably damaging 1.00
R0230:Smarca4 UTSW 9 21700872 missense probably damaging 0.99
R0269:Smarca4 UTSW 9 21636201 missense probably benign 0.09
R0631:Smarca4 UTSW 9 21658984 splice site probably benign
R0665:Smarca4 UTSW 9 21700943 small deletion probably benign
R0726:Smarca4 UTSW 9 21700139 critical splice donor site probably null
R0801:Smarca4 UTSW 9 21642554 missense possibly damaging 0.81
R0918:Smarca4 UTSW 9 21636215 missense probably benign 0.16
R1411:Smarca4 UTSW 9 21658955 missense probably damaging 1.00
R1604:Smarca4 UTSW 9 21700943 small deletion probably benign
R2004:Smarca4 UTSW 9 21677480 missense probably damaging 1.00
R2031:Smarca4 UTSW 9 21686062 missense possibly damaging 0.68
R2211:Smarca4 UTSW 9 21686029 missense probably damaging 1.00
R2512:Smarca4 UTSW 9 21635698 missense possibly damaging 0.95
R2875:Smarca4 UTSW 9 21642580 missense possibly damaging 0.55
R3786:Smarca4 UTSW 9 21672059 missense possibly damaging 0.94
R4829:Smarca4 UTSW 9 21639327 missense probably damaging 0.97
R5084:Smarca4 UTSW 9 21660763 missense probably damaging 1.00
R5222:Smarca4 UTSW 9 21655706 missense probably benign 0.01
R5785:Smarca4 UTSW 9 21686026 missense probably damaging 0.99
R5844:Smarca4 UTSW 9 21677942 intron probably benign
R5964:Smarca4 UTSW 9 21647430 missense probably benign 0.00
R6001:Smarca4 UTSW 9 21632909 unclassified probably benign
R6072:Smarca4 UTSW 9 21700121 missense probably damaging 1.00
R6254:Smarca4 UTSW 9 21699877 missense probably damaging 1.00
R6320:Smarca4 UTSW 9 21637375 missense probably damaging 1.00
R6353:Smarca4 UTSW 9 21679149 critical splice donor site probably null
R6461:Smarca4 UTSW 9 21679020 missense probably damaging 1.00
R6886:Smarca4 UTSW 9 21658831 missense probably damaging 1.00
R7098:Smarca4 UTSW 9 21634820 missense probably benign 0.10
R7253:Smarca4 UTSW 9 21658960 missense probably benign 0.01
R7307:Smarca4 UTSW 9 21638800 missense probably damaging 1.00
R7382:Smarca4 UTSW 9 21658933 missense probably damaging 0.98
R7445:Smarca4 UTSW 9 21686247 missense probably damaging 1.00
R7535:Smarca4 UTSW 9 21647625 missense possibly damaging 0.82
R7573:Smarca4 UTSW 9 21639075 splice site probably null
R7644:Smarca4 UTSW 9 21655654 missense probably benign 0.00
R7734:Smarca4 UTSW 9 21667362 missense possibly damaging 0.65
R7833:Smarca4 UTSW 9 21647359 missense possibly damaging 0.86
R8085:Smarca4 UTSW 9 21658812 splice site probably null
R8119:Smarca4 UTSW 9 21647626 missense possibly damaging 0.61
R8320:Smarca4 UTSW 9 21677502 missense probably benign 0.10
R8445:Smarca4 UTSW 9 21700943 small deletion probably benign
R8493:Smarca4 UTSW 9 21658848 missense probably damaging 1.00
R8748:Smarca4 UTSW 9 21634868 missense possibly damaging 0.85
R8788:Smarca4 UTSW 9 21638728 missense probably damaging 1.00
R8817:Smarca4 UTSW 9 21636201 missense probably benign 0.04
R9185:Smarca4 UTSW 9 21700943 small deletion probably benign
R9241:Smarca4 UTSW 9 21639308 missense possibly damaging 0.72
Z1176:Smarca4 UTSW 9 21702957 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTATGAGGACTCCATCGTCCTGC -3'
(R):5'- GCTCTGTTTTCCACAGACACAGACC -3'

Sequencing Primer
(F):5'- aggaggaggagggcgag -3'
(R):5'- GACACAGACCTGTCCTATCCTG -3'
Posted On 2014-05-23